Incidental Mutation 'R7417:Ripor2'
ID575404
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene NameRHO family interacting cell polarization regulator 2
Synonyms6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R7417 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location24582189-24733816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24696550 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 411 (D411G)
Ref Sequence ENSEMBL: ENSMUSP00000106013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]
Predicted Effect probably damaging
Transcript: ENSMUST00000038477
AA Change: D411G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: D411G

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
low complexity region 461 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058009
SMART Domains Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091694
SMART Domains Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
coiled coil region 111 140 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110383
AA Change: D386G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: D386G

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110384
AA Change: D411G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: D411G

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132689
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik G A 17: 48,152,889 T213I probably damaging Het
Akr1b7 G A 6: 34,417,365 probably null Het
Aldh6a1 T C 12: 84,441,782 Q110R probably benign Het
Alg11 A T 8: 22,062,028 T63S probably benign Het
Ankrd13b A G 11: 77,476,194 Y271H probably damaging Het
Ano8 T A 8: 71,480,833 D605V unknown Het
Best2 C T 8: 85,009,666 probably null Het
Brca1 A G 11: 101,524,981 S776P probably damaging Het
Capn7 T C 14: 31,370,706 Y737H probably damaging Het
Cblc A T 7: 19,788,974 S333T probably benign Het
Ccm2 T A 11: 6,593,091 M257K probably benign Het
Cd320 T A 17: 33,847,556 C103* probably null Het
Cd53 A G 3: 106,768,919 F44S probably benign Het
Col9a2 G A 4: 121,054,292 R610H not run Het
Cubn T C 2: 13,426,967 I1272V probably benign Het
Cyp2j7 C T 4: 96,201,988 probably null Het
Dmrt2 A T 19: 25,678,598 R520S probably benign Het
Drg2 A G 11: 60,454,680 M1V probably null Het
Ect2 A G 3: 27,098,419 S908P probably damaging Het
Eipr1 A G 12: 28,866,955 T341A probably benign Het
Ell3 A C 2: 121,440,410 I214R probably benign Het
Emsy A T 7: 98,615,486 L568Q probably damaging Het
Foxd4 T C 19: 24,900,462 T125A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gcsam C A 16: 45,619,877 H94Q probably damaging Het
Ginm1 T A 10: 7,774,080 I150F probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hk2 G A 6: 82,743,345 A205V probably damaging Het
Il3ra A T 14: 14,349,345 H147L probably benign Het
Map3k6 T A 4: 133,248,396 S732T probably benign Het
Masp2 A G 4: 148,605,721 E229G probably benign Het
Mccc2 A G 13: 99,971,777 probably null Het
Mia3 A G 1: 183,327,653 V359A Het
Mob1a A T 6: 83,332,510 T80S probably benign Het
Msantd2 G A 9: 37,523,294 G478S probably damaging Het
Mtf1 A G 4: 124,825,181 E329G probably null Het
Myh9 T A 15: 77,763,865 K1804* probably null Het
Ndst3 A G 3: 123,671,664 W220R probably damaging Het
Nln A G 13: 104,036,970 L576P probably damaging Het
Nlrc4 A G 17: 74,446,488 M300T probably benign Het
Obscn G T 11: 59,129,577 D880E possibly damaging Het
Olfr1313 A C 2: 112,072,100 V161G probably benign Het
Olfr136 T A 17: 38,335,292 I45N probably damaging Het
Oprd1 T C 4: 132,117,452 T82A probably damaging Het
Orc3 A G 4: 34,595,136 C278R probably damaging Het
Pde4d T A 13: 109,632,788 probably null Het
Pms1 T C 1: 53,197,072 E683G probably benign Het
Prdm2 A T 4: 143,179,299 Y73N probably damaging Het
Prkaa2 T C 4: 105,075,543 Q36R probably benign Het
Psg22 A G 7: 18,722,966 E258G probably damaging Het
Ptprf T C 4: 118,212,172 D1566G probably damaging Het
Rfwd3 T A 8: 111,273,069 Y759F probably benign Het
Ryr2 A C 13: 11,556,748 probably null Het
Sdr42e1 T C 8: 117,662,751 T384A probably benign Het
Sec1 A T 7: 45,684,725 probably null Het
Sec16a A T 2: 26,421,397 F616I Het
Sipa1l2 T C 8: 125,482,106 D521G possibly damaging Het
Smc1b T A 15: 85,097,542 Q759L probably benign Het
Snph A T 2: 151,600,343 S57R probably damaging Het
Sqor A T 2: 122,787,530 T103S probably benign Het
Srbd1 A G 17: 86,136,321 V159A probably benign Het
Srsf2 A T 11: 116,852,901 V10E probably damaging Het
Swap70 T A 7: 110,264,109 probably null Het
Synm A C 7: 67,733,206 *675G probably null Het
Tek A G 4: 94,811,345 E320G probably benign Het
Tenm3 T C 8: 48,236,183 D2123G probably damaging Het
Tmod4 A G 3: 95,125,863 K56R possibly damaging Het
Top3b G A 16: 16,877,850 probably benign Het
Tssc4 G T 7: 143,070,688 E244D possibly damaging Het
Twnk G A 19: 45,010,564 probably null Het
Ube4a A C 9: 44,956,713 I45S probably benign Het
Unc79 A T 12: 103,088,758 M954L possibly damaging Het
Vcpip1 A T 1: 9,746,315 D614E probably benign Het
Vmn1r45 T A 6: 89,933,053 I312L probably benign Het
Vmn1r77 A G 7: 12,041,684 Y129C probably damaging Het
Wdr63 A T 3: 146,093,080 probably null Het
Zer1 A G 2: 30,102,822 L600P probably damaging Het
Zfp266 T C 9: 20,500,936 T114A probably benign Het
Zrsr1 T C 11: 22,974,662 probably null Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24701207 missense probably benign 0.11
IGL02145:Ripor2 APN 13 24717571 missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24695566 splice site probably benign
IGL02533:Ripor2 APN 13 24701395 nonsense probably null
IGL02798:Ripor2 APN 13 24674666 missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24695698 missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24696529 missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24723719 missense probably damaging 1.00
gentleman UTSW 13 24694145 missense probably damaging 1.00
Jack UTSW 13 24677841 nonsense probably null
whitechapel UTSW 13 24673112 critical splice donor site probably null
R0045:Ripor2 UTSW 13 24694226 missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24680632 missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24680644 missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24694186 missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24677841 nonsense probably null
R1374:Ripor2 UTSW 13 24673112 critical splice donor site probably null
R1564:Ripor2 UTSW 13 24675785 missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24701254 missense probably benign 0.10
R1889:Ripor2 UTSW 13 24693887 missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24713718 missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24721834 critical splice donor site probably null
R2209:Ripor2 UTSW 13 24701612 missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24671772 missense probably benign 0.08
R2392:Ripor2 UTSW 13 24706223 missense probably benign 0.00
R2994:Ripor2 UTSW 13 24701627 missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24696538 missense probably benign
R4287:Ripor2 UTSW 13 24725009 missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4365:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4366:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4868:Ripor2 UTSW 13 24694141 missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24674666 missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24614644 start gained probably benign
R6157:Ripor2 UTSW 13 24701069 missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24710130 missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24677845 missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24675820 missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24706232 missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24671846 missense probably benign 0.00
R7041:Ripor2 UTSW 13 24693766 missense probably benign 0.18
R7196:Ripor2 UTSW 13 24704825 missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24671903 missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24694145 missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24701444 nonsense probably null
R7426:Ripor2 UTSW 13 24694205 missense probably benign 0.01
R7448:Ripor2 UTSW 13 24670071 missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24696307 missense unknown
R7499:Ripor2 UTSW 13 24693772 missense probably damaging 0.99
R8081:Ripor2 UTSW 13 24713700 missense probably benign 0.01
R8157:Ripor2 UTSW 13 24695617 missense probably benign 0.05
R8364:Ripor2 UTSW 13 24710193 missense possibly damaging 0.95
R8447:Ripor2 UTSW 13 24723788 missense probably damaging 1.00
R8465:Ripor2 UTSW 13 24665468 intron probably benign
R8751:Ripor2 UTSW 13 24701067 missense possibly damaging 0.69
R8818:Ripor2 UTSW 13 24717668 missense not run
Predicted Primers PCR Primer
(F):5'- CCGAGCATTCTACGACATGAATC -3'
(R):5'- CATGCAAGACCATGCTTCCC -3'

Sequencing Primer
(F):5'- TGAATGACGCCTGCTTGAC -3'
(R):5'- TGCTTCCCACCCCAAGG -3'
Posted On2019-10-07