Incidental Mutation 'R7417:Capn7'
ID575408
Institutional Source Beutler Lab
Gene Symbol Capn7
Ensembl Gene ENSMUSG00000021893
Gene Namecalpain 7
SynonymsPalBH
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R7417 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31336638-31371986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31370706 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 737 (Y737H)
Ref Sequence ENSEMBL: ENSMUSP00000022451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022451] [ENSMUST00000091903] [ENSMUST00000100730] [ENSMUST00000140002] [ENSMUST00000143472] [ENSMUST00000152182]
Predicted Effect probably damaging
Transcript: ENSMUST00000022451
AA Change: Y737H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022451
Gene: ENSMUSG00000021893
AA Change: Y737H

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 547 1.08e-91 SMART
Blast:CysPc 550 620 4e-39 BLAST
calpain_III 686 810 2.78e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091903
SMART Domains Protein: ENSMUSP00000089517
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.2e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100730
SMART Domains Protein: ENSMUSP00000098296
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 60 274 5.5e-95 PFAM
low complexity region 321 333 N/A INTRINSIC
low complexity region 405 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140002
SMART Domains Protein: ENSMUSP00000117152
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.3e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143472
SMART Domains Protein: ENSMUSP00000118596
Gene: ENSMUSG00000021893

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152182
SMART Domains Protein: ENSMUSP00000119214
Gene: ENSMUSG00000021893

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The function of the protein encoded by this gene is not known. An orthologue has been found in mouse but it seems to diverge from other family members. The mouse orthologue is thought to be calcium independent with protease activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene frequently die before weaning. Survivors display reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik G A 17: 48,152,889 T213I probably damaging Het
Akr1b7 G A 6: 34,417,365 probably null Het
Aldh6a1 T C 12: 84,441,782 Q110R probably benign Het
Alg11 A T 8: 22,062,028 T63S probably benign Het
Ankrd13b A G 11: 77,476,194 Y271H probably damaging Het
Ano8 T A 8: 71,480,833 D605V unknown Het
Best2 C T 8: 85,009,666 probably null Het
Brca1 A G 11: 101,524,981 S776P probably damaging Het
Cblc A T 7: 19,788,974 S333T probably benign Het
Ccm2 T A 11: 6,593,091 M257K probably benign Het
Cd320 T A 17: 33,847,556 C103* probably null Het
Cd53 A G 3: 106,768,919 F44S probably benign Het
Col9a2 G A 4: 121,054,292 R610H not run Het
Cubn T C 2: 13,426,967 I1272V probably benign Het
Cyp2j7 C T 4: 96,201,988 probably null Het
Dmrt2 A T 19: 25,678,598 R520S probably benign Het
Drg2 A G 11: 60,454,680 M1V probably null Het
Ect2 A G 3: 27,098,419 S908P probably damaging Het
Eipr1 A G 12: 28,866,955 T341A probably benign Het
Ell3 A C 2: 121,440,410 I214R probably benign Het
Emsy A T 7: 98,615,486 L568Q probably damaging Het
Foxd4 T C 19: 24,900,462 T125A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gcsam C A 16: 45,619,877 H94Q probably damaging Het
Ginm1 T A 10: 7,774,080 I150F probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hk2 G A 6: 82,743,345 A205V probably damaging Het
Il3ra A T 14: 14,349,345 H147L probably benign Het
Map3k6 T A 4: 133,248,396 S732T probably benign Het
Masp2 A G 4: 148,605,721 E229G probably benign Het
Mccc2 A G 13: 99,971,777 probably null Het
Mia3 A G 1: 183,327,653 V359A Het
Mob1a A T 6: 83,332,510 T80S probably benign Het
Msantd2 G A 9: 37,523,294 G478S probably damaging Het
Mtf1 A G 4: 124,825,181 E329G probably null Het
Myh9 T A 15: 77,763,865 K1804* probably null Het
Ndst3 A G 3: 123,671,664 W220R probably damaging Het
Nln A G 13: 104,036,970 L576P probably damaging Het
Nlrc4 A G 17: 74,446,488 M300T probably benign Het
Obscn G T 11: 59,129,577 D880E possibly damaging Het
Olfr1313 A C 2: 112,072,100 V161G probably benign Het
Olfr136 T A 17: 38,335,292 I45N probably damaging Het
Oprd1 T C 4: 132,117,452 T82A probably damaging Het
Orc3 A G 4: 34,595,136 C278R probably damaging Het
Pde4d T A 13: 109,632,788 probably null Het
Pms1 T C 1: 53,197,072 E683G probably benign Het
Prdm2 A T 4: 143,179,299 Y73N probably damaging Het
Prkaa2 T C 4: 105,075,543 Q36R probably benign Het
Psg22 A G 7: 18,722,966 E258G probably damaging Het
Ptprf T C 4: 118,212,172 D1566G probably damaging Het
Rfwd3 T A 8: 111,273,069 Y759F probably benign Het
Ripor2 A G 13: 24,696,550 D411G probably damaging Het
Ryr2 A C 13: 11,556,748 probably null Het
Sdr42e1 T C 8: 117,662,751 T384A probably benign Het
Sec1 A T 7: 45,684,725 probably null Het
Sec16a A T 2: 26,421,397 F616I Het
Sipa1l2 T C 8: 125,482,106 D521G possibly damaging Het
Smc1b T A 15: 85,097,542 Q759L probably benign Het
Snph A T 2: 151,600,343 S57R probably damaging Het
Sqor A T 2: 122,787,530 T103S probably benign Het
Srbd1 A G 17: 86,136,321 V159A probably benign Het
Srsf2 A T 11: 116,852,901 V10E probably damaging Het
Swap70 T A 7: 110,264,109 probably null Het
Synm A C 7: 67,733,206 *675G probably null Het
Tek A G 4: 94,811,345 E320G probably benign Het
Tenm3 T C 8: 48,236,183 D2123G probably damaging Het
Tmod4 A G 3: 95,125,863 K56R possibly damaging Het
Top3b G A 16: 16,877,850 probably benign Het
Tssc4 G T 7: 143,070,688 E244D possibly damaging Het
Twnk G A 19: 45,010,564 probably null Het
Ube4a A C 9: 44,956,713 I45S probably benign Het
Unc79 A T 12: 103,088,758 M954L possibly damaging Het
Vcpip1 A T 1: 9,746,315 D614E probably benign Het
Vmn1r45 T A 6: 89,933,053 I312L probably benign Het
Vmn1r77 A G 7: 12,041,684 Y129C probably damaging Het
Wdr63 A T 3: 146,093,080 probably null Het
Zer1 A G 2: 30,102,822 L600P probably damaging Het
Zfp266 T C 9: 20,500,936 T114A probably benign Het
Zrsr1 T C 11: 22,974,662 probably null Het
Other mutations in Capn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Capn7 APN 14 31363578 missense probably benign 0.41
IGL01481:Capn7 APN 14 31355339 missense probably damaging 1.00
IGL03231:Capn7 APN 14 31355290 missense probably damaging 1.00
R0018:Capn7 UTSW 14 31354112 nonsense probably null
R0018:Capn7 UTSW 14 31354112 nonsense probably null
R0060:Capn7 UTSW 14 31365604 splice site probably benign
R0060:Capn7 UTSW 14 31365604 splice site probably benign
R0077:Capn7 UTSW 14 31368115 missense probably benign 0.10
R0195:Capn7 UTSW 14 31365581 missense probably damaging 1.00
R0316:Capn7 UTSW 14 31347809 missense probably benign 0.00
R0815:Capn7 UTSW 14 31369757 missense possibly damaging 0.85
R0863:Capn7 UTSW 14 31369757 missense possibly damaging 0.85
R1697:Capn7 UTSW 14 31360160 missense probably damaging 1.00
R1954:Capn7 UTSW 14 31360150 missense probably damaging 1.00
R2096:Capn7 UTSW 14 31349887 critical splice donor site probably null
R3121:Capn7 UTSW 14 31359210 missense probably damaging 1.00
R3122:Capn7 UTSW 14 31359210 missense probably damaging 1.00
R4409:Capn7 UTSW 14 31355339 missense probably damaging 1.00
R4676:Capn7 UTSW 14 31359259 missense possibly damaging 0.72
R4799:Capn7 UTSW 14 31360557 missense probably benign 0.01
R5023:Capn7 UTSW 14 31352426 missense probably damaging 0.99
R5129:Capn7 UTSW 14 31344511 missense probably damaging 0.99
R5460:Capn7 UTSW 14 31368203 critical splice donor site probably null
R5608:Capn7 UTSW 14 31370707 missense probably damaging 1.00
R5665:Capn7 UTSW 14 31369802 missense probably benign 0.00
R5786:Capn7 UTSW 14 31360145 missense probably damaging 1.00
R6186:Capn7 UTSW 14 31370918 missense probably damaging 1.00
R6190:Capn7 UTSW 14 31363603 missense probably benign 0.10
R6411:Capn7 UTSW 14 31340096 missense probably benign 0.00
R6514:Capn7 UTSW 14 31344554 missense probably benign 0.00
R6838:Capn7 UTSW 14 31354173 missense possibly damaging 0.95
R7041:Capn7 UTSW 14 31336685 unclassified probably benign
R7047:Capn7 UTSW 14 31336685 unclassified probably benign
R7124:Capn7 UTSW 14 31336685 unclassified probably benign
R7224:Capn7 UTSW 14 31370721 nonsense probably null
R7419:Capn7 UTSW 14 31349822 missense probably benign 0.02
R7544:Capn7 UTSW 14 31340050 missense probably damaging 1.00
R7699:Capn7 UTSW 14 31352444 missense probably benign 0.00
R7700:Capn7 UTSW 14 31352444 missense probably benign 0.00
R7775:Capn7 UTSW 14 31352410 missense probably benign 0.00
R7824:Capn7 UTSW 14 31352410 missense probably benign 0.00
R7908:Capn7 UTSW 14 31366245 critical splice donor site probably null
R7989:Capn7 UTSW 14 31366245 critical splice donor site probably null
R8057:Capn7 UTSW 14 31370979 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CGGTTCTTGGAATGCCATATGG -3'
(R):5'- CCCAGCAGGTATGTTTTCCAG -3'

Sequencing Primer
(F):5'- CTACATAGTGAGTTCCAGGACAGTC -3'
(R):5'- CAGCAGGTATGTTTTCCAGTTCTAAG -3'
Posted On2019-10-07