Incidental Mutation 'R7417:Top3b'
ID575411
Institutional Source Beutler Lab
Gene Symbol Top3b
Ensembl Gene ENSMUSG00000022779
Gene Nametopoisomerase (DNA) III beta
SynonymsTopo III beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R7417 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location16870736-16892990 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 16877850 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023465] [ENSMUST00000231812] [ENSMUST00000232017] [ENSMUST00000232080] [ENSMUST00000232200] [ENSMUST00000232231] [ENSMUST00000232547] [ENSMUST00000232581]
Predicted Effect probably benign
Transcript: ENSMUST00000023465
SMART Domains Protein: ENSMUSP00000023465
Gene: ENSMUSG00000022779

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 242 3.84e-38 SMART
TOP1Ac 289 545 2.28e-104 SMART
low complexity region 824 850 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231812
Predicted Effect probably benign
Transcript: ENSMUST00000232017
Predicted Effect probably benign
Transcript: ENSMUST00000232080
Predicted Effect probably benign
Transcript: ENSMUST00000232200
Predicted Effect probably benign
Transcript: ENSMUST00000232231
Predicted Effect probably benign
Transcript: ENSMUST00000232547
Predicted Effect probably benign
Transcript: ENSMUST00000232581
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus relaxing the supercoils and altering the topology of DNA. The enzyme interacts with DNA helicase SGS1 and plays a role in DNA recombination, cellular aging and maintenance of genome stability. Low expression of this gene may be related to higher survival rates in breast cancer patients. This gene has a pseudogene on chromosome 22. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice develop to maturity but die prematurely showing enlargement of lymphatic organs and glomerulonephritis. Intercrossing of mutant mice progressively results in infertility that is correlated to increased aneuploidy in germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik G A 17: 48,152,889 T213I probably damaging Het
Akr1b7 G A 6: 34,417,365 probably null Het
Aldh6a1 T C 12: 84,441,782 Q110R probably benign Het
Alg11 A T 8: 22,062,028 T63S probably benign Het
Ankrd13b A G 11: 77,476,194 Y271H probably damaging Het
Ano8 T A 8: 71,480,833 D605V unknown Het
Best2 C T 8: 85,009,666 probably null Het
Brca1 A G 11: 101,524,981 S776P probably damaging Het
Capn7 T C 14: 31,370,706 Y737H probably damaging Het
Cblc A T 7: 19,788,974 S333T probably benign Het
Ccm2 T A 11: 6,593,091 M257K probably benign Het
Cd320 T A 17: 33,847,556 C103* probably null Het
Cd53 A G 3: 106,768,919 F44S probably benign Het
Col9a2 G A 4: 121,054,292 R610H not run Het
Cubn T C 2: 13,426,967 I1272V probably benign Het
Cyp2j7 C T 4: 96,201,988 probably null Het
Dmrt2 A T 19: 25,678,598 R520S probably benign Het
Drg2 A G 11: 60,454,680 M1V probably null Het
Ect2 A G 3: 27,098,419 S908P probably damaging Het
Eipr1 A G 12: 28,866,955 T341A probably benign Het
Ell3 A C 2: 121,440,410 I214R probably benign Het
Emsy A T 7: 98,615,486 L568Q probably damaging Het
Foxd4 T C 19: 24,900,462 T125A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gcsam C A 16: 45,619,877 H94Q probably damaging Het
Ginm1 T A 10: 7,774,080 I150F probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hk2 G A 6: 82,743,345 A205V probably damaging Het
Il3ra A T 14: 14,349,345 H147L probably benign Het
Map3k6 T A 4: 133,248,396 S732T probably benign Het
Masp2 A G 4: 148,605,721 E229G probably benign Het
Mccc2 A G 13: 99,971,777 probably null Het
Mia3 A G 1: 183,327,653 V359A Het
Mob1a A T 6: 83,332,510 T80S probably benign Het
Msantd2 G A 9: 37,523,294 G478S probably damaging Het
Mtf1 A G 4: 124,825,181 E329G probably null Het
Myh9 T A 15: 77,763,865 K1804* probably null Het
Ndst3 A G 3: 123,671,664 W220R probably damaging Het
Nln A G 13: 104,036,970 L576P probably damaging Het
Nlrc4 A G 17: 74,446,488 M300T probably benign Het
Obscn G T 11: 59,129,577 D880E possibly damaging Het
Olfr1313 A C 2: 112,072,100 V161G probably benign Het
Olfr136 T A 17: 38,335,292 I45N probably damaging Het
Oprd1 T C 4: 132,117,452 T82A probably damaging Het
Orc3 A G 4: 34,595,136 C278R probably damaging Het
Pde4d T A 13: 109,632,788 probably null Het
Pms1 T C 1: 53,197,072 E683G probably benign Het
Prdm2 A T 4: 143,179,299 Y73N probably damaging Het
Prkaa2 T C 4: 105,075,543 Q36R probably benign Het
Psg22 A G 7: 18,722,966 E258G probably damaging Het
Ptprf T C 4: 118,212,172 D1566G probably damaging Het
Rfwd3 T A 8: 111,273,069 Y759F probably benign Het
Ripor2 A G 13: 24,696,550 D411G probably damaging Het
Ryr2 A C 13: 11,556,748 probably null Het
Sdr42e1 T C 8: 117,662,751 T384A probably benign Het
Sec1 A T 7: 45,684,725 probably null Het
Sec16a A T 2: 26,421,397 F616I Het
Sipa1l2 T C 8: 125,482,106 D521G possibly damaging Het
Smc1b T A 15: 85,097,542 Q759L probably benign Het
Snph A T 2: 151,600,343 S57R probably damaging Het
Sqor A T 2: 122,787,530 T103S probably benign Het
Srbd1 A G 17: 86,136,321 V159A probably benign Het
Srsf2 A T 11: 116,852,901 V10E probably damaging Het
Swap70 T A 7: 110,264,109 probably null Het
Synm A C 7: 67,733,206 *675G probably null Het
Tek A G 4: 94,811,345 E320G probably benign Het
Tenm3 T C 8: 48,236,183 D2123G probably damaging Het
Tmod4 A G 3: 95,125,863 K56R possibly damaging Het
Tssc4 G T 7: 143,070,688 E244D possibly damaging Het
Twnk G A 19: 45,010,564 probably null Het
Ube4a A C 9: 44,956,713 I45S probably benign Het
Unc79 A T 12: 103,088,758 M954L possibly damaging Het
Vcpip1 A T 1: 9,746,315 D614E probably benign Het
Vmn1r45 T A 6: 89,933,053 I312L probably benign Het
Vmn1r77 A G 7: 12,041,684 Y129C probably damaging Het
Wdr63 A T 3: 146,093,080 probably null Het
Zer1 A G 2: 30,102,822 L600P probably damaging Het
Zfp266 T C 9: 20,500,936 T114A probably benign Het
Zrsr1 T C 11: 22,974,662 probably null Het
Other mutations in Top3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Top3b APN 16 16887622 missense probably damaging 0.97
IGL01512:Top3b APN 16 16891422 missense possibly damaging 0.74
IGL01552:Top3b APN 16 16887823 splice site probably benign
IGL01738:Top3b APN 16 16880604 missense probably benign 0.04
IGL02090:Top3b APN 16 16891470 missense possibly damaging 0.81
R0143:Top3b UTSW 16 16883525 missense probably damaging 0.97
R0883:Top3b UTSW 16 16879437 splice site probably benign
R1386:Top3b UTSW 16 16880629 missense probably benign 0.29
R1440:Top3b UTSW 16 16892777 nonsense probably null
R1958:Top3b UTSW 16 16884302 missense possibly damaging 0.52
R1970:Top3b UTSW 16 16883519 missense probably damaging 1.00
R4211:Top3b UTSW 16 16882532 unclassified probably null
R4292:Top3b UTSW 16 16883519 missense probably damaging 1.00
R4307:Top3b UTSW 16 16889617 splice site probably benign
R4832:Top3b UTSW 16 16890662 nonsense probably null
R5047:Top3b UTSW 16 16891418 missense probably benign 0.00
R5364:Top3b UTSW 16 16886970 missense probably benign 0.00
R5590:Top3b UTSW 16 16891577 intron probably benign
R5604:Top3b UTSW 16 16889535 nonsense probably null
R5719:Top3b UTSW 16 16885836 missense probably damaging 1.00
R5969:Top3b UTSW 16 16883565 critical splice donor site probably null
R6018:Top3b UTSW 16 16892892 missense probably damaging 1.00
R6144:Top3b UTSW 16 16879141 unclassified probably null
R6155:Top3b UTSW 16 16891509 missense probably damaging 1.00
R6341:Top3b UTSW 16 16879071 missense probably damaging 0.98
R6700:Top3b UTSW 16 16892669 missense possibly damaging 0.48
R7586:Top3b UTSW 16 16891368 missense probably benign 0.44
R7747:Top3b UTSW 16 16887721 missense probably benign 0.17
X0011:Top3b UTSW 16 16890189 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTGGATACTTCAGCAGTAGC -3'
(R):5'- GCAATCAAACAGCCTAGTGTTTG -3'

Sequencing Primer
(F):5'- TGGATACTTCAGCAGTAGCTACAC -3'
(R):5'- AAACAGCCTAGTGTTTGTTTTTCC -3'
Posted On2019-10-07