Incidental Mutation 'R7418:Inpp5d'
ID575425
Institutional Source Beutler Lab
Gene Symbol Inpp5d
Ensembl Gene ENSMUSG00000026288
Gene Nameinositol polyphosphate-5-phosphatase D
Synonymss-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R7418 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87620312-87720507 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 87708211 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]
Predicted Effect probably null
Transcript: ENSMUST00000042275
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072999
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167032
SMART Domains Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 692 717 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168783
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169754
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170300
SMART Domains Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 796 808 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 T G 10: 91,023,835 H827P probably benign Het
Atp8b3 A T 10: 80,530,092 L308Q probably damaging Het
Ccdc180 T C 4: 45,904,616 L404P probably damaging Het
Cdh13 G A 8: 119,312,525 G569R probably damaging Het
Clec14a G A 12: 58,268,647 T63I probably damaging Het
Cngb1 G T 8: 95,278,259 S487* probably null Het
Cog5 A T 12: 31,833,241 N390Y probably damaging Het
Col6a4 C T 9: 106,022,915 G1670S probably damaging Het
Daxx T A 17: 33,910,605 D53E probably benign Het
Dnah14 C T 1: 181,616,742 T539I possibly damaging Het
Dnajc2 A G 5: 21,760,624 probably null Het
Ehmt1 C T 2: 24,884,634 G53R probably benign Het
Eif2b1 T A 5: 124,576,830 N113Y probably benign Het
Eya3 A G 4: 132,680,848 T152A possibly damaging Het
Fam234b G A 6: 135,217,011 V221M probably benign Het
Fbxl13 T A 5: 21,581,983 T319S probably benign Het
Fchsd2 G T 7: 101,271,624 V479F possibly damaging Het
Fgd5 T C 6: 92,024,538 S905P probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Fxn C T 19: 24,280,496 V24I probably benign Het
Gapvd1 C T 2: 34,725,118 D456N probably benign Het
Gm128 C T 3: 95,240,567 V139M possibly damaging Het
Gm973 A G 1: 59,526,813 T64A probably damaging Het
Gtf2h5 T A 17: 6,084,628 N64K probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Haus6 A G 4: 86,594,773 S386P possibly damaging Het
Hsh2d A G 8: 72,196,794 probably null Het
Htt T C 5: 34,790,353 M125T possibly damaging Het
Ints4 G A 7: 97,490,972 A137T probably benign Het
Isl2 A G 9: 55,544,352 D263G probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Jpt1 A T 11: 115,498,269 L116Q probably damaging Het
Kansl2 A G 15: 98,531,894 S86P possibly damaging Het
Kat2b G T 17: 53,610,925 R104I possibly damaging Het
Kcna10 C A 3: 107,195,046 A331D probably benign Het
Kcnk3 G A 5: 30,622,331 V242M possibly damaging Het
Kdm4a A G 4: 118,160,243 L542P probably damaging Het
Kif20b T C 19: 34,929,687 F119L probably damaging Het
Krtcap3 A T 5: 31,252,537 H149L probably benign Het
Lhx4 A G 1: 155,710,259 V102A probably damaging Het
Luc7l T A 17: 26,253,182 probably benign Het
Myh15 G T 16: 49,155,537 A1323S possibly damaging Het
Myl1 T A 1: 66,926,179 R151S unknown Het
Naif1 A G 2: 32,452,571 S45G probably benign Het
Ndst4 C T 3: 125,708,151 T121I probably damaging Het
Neurod6 C T 6: 55,679,298 R118Q probably damaging Het
Npl A T 1: 153,537,511 probably null Het
Nr4a3 T C 4: 48,051,476 Y77H probably damaging Het
Olfr1254 A T 2: 89,788,976 C125* probably null Het
Olfr1270 T G 2: 90,149,487 D173A probably damaging Het
Pex11a G A 7: 79,742,987 probably benign Het
Rab44 T A 17: 29,140,496 F553I unknown Het
Sbf2 C T 7: 110,365,821 R1002H probably damaging Het
Sectm1a C A 11: 121,069,293 probably null Het
Slit3 G A 11: 35,686,428 V1163M possibly damaging Het
Sphk2 G A 7: 45,711,756 R275C probably damaging Het
Tango6 A G 8: 106,688,834 S96G probably benign Het
Tg A G 15: 66,696,583 E1373G probably damaging Het
Traf3ip1 T A 1: 91,507,736 probably null Het
Trp53 T C 11: 69,588,388 F131L probably damaging Het
Ttc21a A T 9: 119,959,051 E847D probably benign Het
Ttn A G 2: 76,772,447 F18477S probably damaging Het
Usp25 A T 16: 77,113,842 R929* probably null Het
Usp49 G T 17: 47,672,168 E33* probably null Het
Vmn1r63 A G 7: 5,803,555 V26A possibly damaging Het
Vmn1r74 A T 7: 11,847,154 Y127F possibly damaging Het
Wdfy3 C T 5: 101,957,500 V154I probably benign Het
Xdh A G 17: 73,913,965 S590P possibly damaging Het
Zkscan4 A G 13: 21,484,629 K446E probably damaging Het
Other mutations in Inpp5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87683815 missense probably benign 0.00
IGL00329:Inpp5d APN 1 87668003 missense probably benign 0.00
IGL00897:Inpp5d APN 1 87712114 missense probably benign 0.14
IGL01314:Inpp5d APN 1 87683750 nonsense probably null
IGL02145:Inpp5d APN 1 87715055 missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87708132 missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87695366 missense probably null 0.92
IGL02680:Inpp5d APN 1 87701483 missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87711141 missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87703197 missense probably damaging 1.00
americas UTSW 1 87715142 missense probably damaging 1.00
Apfelsine UTSW 1 87683845 nonsense probably null
auburn UTSW 1 87681680 splice site probably null
naranjo UTSW 1 87708211 critical splice donor site probably null
New_black UTSW 1 87709675 missense probably damaging 1.00
Orange UTSW 1 87697546 critical splice donor site probably null
pantone UTSW 1 87699675 missense probably damaging 1.00
sailing UTSW 1 87705964 missense probably damaging 1.00
Salamander UTSW 1 87695380 missense probably damaging 0.99
Sandstone UTSW 1 87695400 missense probably damaging 1.00
styx UTSW 1 87669784 critical splice donor site probably benign
ulster UTSW 1 87701476 nonsense probably null
R0010:Inpp5d UTSW 1 87697546 critical splice donor site probably null
R0037:Inpp5d UTSW 1 87708129 missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87715138 missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87698150 missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87705920 splice site probably benign
R0733:Inpp5d UTSW 1 87668077 splice site probably benign
R1464:Inpp5d UTSW 1 87698105 splice site probably benign
R1576:Inpp5d UTSW 1 87669685 missense probably benign 0.16
R1576:Inpp5d UTSW 1 87681558 missense probably damaging 0.96
R1592:Inpp5d UTSW 1 87665532 missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87699081 missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87667889 missense probably benign 0.30
R1972:Inpp5d UTSW 1 87676314 missense probably benign 0.00
R2024:Inpp5d UTSW 1 87695350 nonsense probably null
R2405:Inpp5d UTSW 1 87699729 missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87701408 splice site probably benign
R4652:Inpp5d UTSW 1 87665451 missense probably benign 0.03
R4676:Inpp5d UTSW 1 87715142 missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87697523 missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87705964 missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87676342 missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87709675 missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87718066 missense probably benign 0.02
R5875:Inpp5d UTSW 1 87717974 missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87620397 unclassified probably null
R6371:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6385:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87676250 start gained probably benign
R6572:Inpp5d UTSW 1 87695396 missense probably damaging 0.99
R6831:Inpp5d UTSW 1 87701476 nonsense probably null
R6853:Inpp5d UTSW 1 87681680 splice site probably null
R6883:Inpp5d UTSW 1 87699690 missense probably damaging 0.98
R7082:Inpp5d UTSW 1 87695380 missense probably damaging 0.99
R7215:Inpp5d UTSW 1 87701218 missense probably benign 0.30
R7471:Inpp5d UTSW 1 87695400 missense probably damaging 1.00
R7593:Inpp5d UTSW 1 87717778 missense possibly damaging 0.82
R7716:Inpp5d UTSW 1 87665399 missense probably damaging 0.97
R7781:Inpp5d UTSW 1 87699672 missense probably damaging 1.00
R7808:Inpp5d UTSW 1 87683845 nonsense probably null
Z1176:Inpp5d UTSW 1 87669709 missense probably benign 0.16
Z1176:Inpp5d UTSW 1 87703131 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGACATTTCCCATCTGTGG -3'
(R):5'- CCTTTGCTGAACCCACTGAG -3'

Sequencing Primer
(F):5'- ATCTGTGGGCCCTCAGAG -3'
(R):5'- ACTGAGGGGTCCATCCATG -3'
Posted On2019-10-07