Incidental Mutation 'R7418:Lhx4'
ID575426
Institutional Source Beutler Lab
Gene Symbol Lhx4
Ensembl Gene ENSMUSG00000026468
Gene NameLIM homeobox protein 4
SynonymsGsh-4, Gsh4, A330062J17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7418 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location155698031-155751684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155710259 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 102 (V102A)
Ref Sequence ENSEMBL: ENSMUSP00000027740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027740] [ENSMUST00000195275]
PDB Structure
The structural basis for partial redundancy in a class of transcription factors, the lim-homeodomain proteins, in neural cell type specification [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027740
AA Change: V102A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027740
Gene: ENSMUSG00000026468
AA Change: V102A

DomainStartEndE-ValueType
LIM 29 80 3.39e-17 SMART
LIM 88 143 2.76e-17 SMART
HOX 157 219 5.79e-23 SMART
low complexity region 306 325 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195275
AA Change: V41A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141662
Gene: ENSMUSG00000026468
AA Change: V41A

DomainStartEndE-ValueType
LIM 27 82 1.3e-19 SMART
HOX 96 158 2.8e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor involved in the control of differentiation and development of the pituitary gland. Mutations in this gene cause combined pituitary hormone deficiency 4. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mutations in this gene result in abnormal lung development and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 T G 10: 91,023,835 H827P probably benign Het
Atp8b3 A T 10: 80,530,092 L308Q probably damaging Het
Ccdc180 T C 4: 45,904,616 L404P probably damaging Het
Cdh13 G A 8: 119,312,525 G569R probably damaging Het
Clec14a G A 12: 58,268,647 T63I probably damaging Het
Cngb1 G T 8: 95,278,259 S487* probably null Het
Cog5 A T 12: 31,833,241 N390Y probably damaging Het
Col6a4 C T 9: 106,022,915 G1670S probably damaging Het
Daxx T A 17: 33,910,605 D53E probably benign Het
Dnah14 C T 1: 181,616,742 T539I possibly damaging Het
Dnajc2 A G 5: 21,760,624 probably null Het
Ehmt1 C T 2: 24,884,634 G53R probably benign Het
Eif2b1 T A 5: 124,576,830 N113Y probably benign Het
Eya3 A G 4: 132,680,848 T152A possibly damaging Het
Fam234b G A 6: 135,217,011 V221M probably benign Het
Fbxl13 T A 5: 21,581,983 T319S probably benign Het
Fchsd2 G T 7: 101,271,624 V479F possibly damaging Het
Fgd5 T C 6: 92,024,538 S905P probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Fxn C T 19: 24,280,496 V24I probably benign Het
Gapvd1 C T 2: 34,725,118 D456N probably benign Het
Gm128 C T 3: 95,240,567 V139M possibly damaging Het
Gm973 A G 1: 59,526,813 T64A probably damaging Het
Gtf2h5 T A 17: 6,084,628 N64K probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Haus6 A G 4: 86,594,773 S386P possibly damaging Het
Hsh2d A G 8: 72,196,794 probably null Het
Htt T C 5: 34,790,353 M125T possibly damaging Het
Inpp5d T A 1: 87,708,211 probably null Het
Ints4 G A 7: 97,490,972 A137T probably benign Het
Isl2 A G 9: 55,544,352 D263G probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Jpt1 A T 11: 115,498,269 L116Q probably damaging Het
Kansl2 A G 15: 98,531,894 S86P possibly damaging Het
Kat2b G T 17: 53,610,925 R104I possibly damaging Het
Kcna10 C A 3: 107,195,046 A331D probably benign Het
Kcnk3 G A 5: 30,622,331 V242M possibly damaging Het
Kdm4a A G 4: 118,160,243 L542P probably damaging Het
Kif20b T C 19: 34,929,687 F119L probably damaging Het
Krtcap3 A T 5: 31,252,537 H149L probably benign Het
Luc7l T A 17: 26,253,182 probably benign Het
Myh15 G T 16: 49,155,537 A1323S possibly damaging Het
Myl1 T A 1: 66,926,179 R151S unknown Het
Naif1 A G 2: 32,452,571 S45G probably benign Het
Ndst4 C T 3: 125,708,151 T121I probably damaging Het
Neurod6 C T 6: 55,679,298 R118Q probably damaging Het
Npl A T 1: 153,537,511 probably null Het
Nr4a3 T C 4: 48,051,476 Y77H probably damaging Het
Olfr1254 A T 2: 89,788,976 C125* probably null Het
Olfr1270 T G 2: 90,149,487 D173A probably damaging Het
Pex11a G A 7: 79,742,987 probably benign Het
Rab44 T A 17: 29,140,496 F553I unknown Het
Sbf2 C T 7: 110,365,821 R1002H probably damaging Het
Sectm1a C A 11: 121,069,293 probably null Het
Slit3 G A 11: 35,686,428 V1163M possibly damaging Het
Sphk2 G A 7: 45,711,756 R275C probably damaging Het
Tango6 A G 8: 106,688,834 S96G probably benign Het
Tg A G 15: 66,696,583 E1373G probably damaging Het
Traf3ip1 T A 1: 91,507,736 probably null Het
Trp53 T C 11: 69,588,388 F131L probably damaging Het
Ttc21a A T 9: 119,959,051 E847D probably benign Het
Ttn A G 2: 76,772,447 F18477S probably damaging Het
Usp25 A T 16: 77,113,842 R929* probably null Het
Usp49 G T 17: 47,672,168 E33* probably null Het
Vmn1r63 A G 7: 5,803,555 V26A possibly damaging Het
Vmn1r74 A T 7: 11,847,154 Y127F possibly damaging Het
Wdfy3 C T 5: 101,957,500 V154I probably benign Het
Xdh A G 17: 73,913,965 S590P possibly damaging Het
Zkscan4 A G 13: 21,484,629 K446E probably damaging Het
Other mutations in Lhx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02366:Lhx4 APN 1 155705188 missense possibly damaging 0.90
IGL02516:Lhx4 APN 1 155702257 missense probably damaging 1.00
IGL02806:Lhx4 APN 1 155702229 missense probably benign 0.22
IGL03104:Lhx4 APN 1 155705221 missense probably damaging 1.00
R3434:Lhx4 UTSW 1 155702401 missense probably damaging 0.99
R3438:Lhx4 UTSW 1 155702484 missense probably benign 0.10
R4369:Lhx4 UTSW 1 155704814 missense probably benign 0.01
R4392:Lhx4 UTSW 1 155710134 missense probably damaging 1.00
R4873:Lhx4 UTSW 1 155705267 missense possibly damaging 0.90
R4875:Lhx4 UTSW 1 155705267 missense possibly damaging 0.90
R5937:Lhx4 UTSW 1 155710277 missense probably damaging 1.00
R6329:Lhx4 UTSW 1 155702554 missense probably benign 0.00
R6694:Lhx4 UTSW 1 155704710 missense probably benign 0.05
R7212:Lhx4 UTSW 1 155724953 missense probably benign 0.01
R7653:Lhx4 UTSW 1 155704871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTTGGACTAGGCTGAGCATC -3'
(R):5'- AGGCCTAGAGTACCCGTAAC -3'

Sequencing Primer
(F):5'- ACTAGGCTGAGCATCCGCAG -3'
(R):5'- GGCCTAGAGTACCCGTAACCTTTAG -3'
Posted On2019-10-07