Incidental Mutation 'R7418:Olfr1254'
ID575432
Institutional Source Beutler Lab
Gene Symbol Olfr1254
Ensembl Gene ENSMUSG00000075074
Gene Nameolfactory receptor 1254
SynonymsGA_x6K02T2Q125-51230155-51229211, MOR231-13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7418 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89787325-89793619 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 89788976 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 125 (C125*)
Ref Sequence ENSEMBL: ENSMUSP00000107148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099764] [ENSMUST00000111523] [ENSMUST00000216587]
Predicted Effect probably null
Transcript: ENSMUST00000099764
AA Change: C125*
SMART Domains Protein: ENSMUSP00000097352
Gene: ENSMUSG00000075074
AA Change: C125*

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 9.7e-30 PFAM
Pfam:7tm_4 137 278 1.3e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111523
AA Change: C125*
SMART Domains Protein: ENSMUSP00000107148
Gene: ENSMUSG00000075074
AA Change: C125*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.4e-46 PFAM
Pfam:7tm_1 39 285 5.6e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216587
AA Change: C125*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 T G 10: 91,023,835 H827P probably benign Het
Atp8b3 A T 10: 80,530,092 L308Q probably damaging Het
Ccdc180 T C 4: 45,904,616 L404P probably damaging Het
Cdh13 G A 8: 119,312,525 G569R probably damaging Het
Clec14a G A 12: 58,268,647 T63I probably damaging Het
Cngb1 G T 8: 95,278,259 S487* probably null Het
Cog5 A T 12: 31,833,241 N390Y probably damaging Het
Col6a4 C T 9: 106,022,915 G1670S probably damaging Het
Daxx T A 17: 33,910,605 D53E probably benign Het
Dnah14 C T 1: 181,616,742 T539I possibly damaging Het
Dnajc2 A G 5: 21,760,624 probably null Het
Ehmt1 C T 2: 24,884,634 G53R probably benign Het
Eif2b1 T A 5: 124,576,830 N113Y probably benign Het
Eya3 A G 4: 132,680,848 T152A possibly damaging Het
Fam234b G A 6: 135,217,011 V221M probably benign Het
Fbxl13 T A 5: 21,581,983 T319S probably benign Het
Fchsd2 G T 7: 101,271,624 V479F possibly damaging Het
Fgd5 T C 6: 92,024,538 S905P probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Fxn C T 19: 24,280,496 V24I probably benign Het
Gapvd1 C T 2: 34,725,118 D456N probably benign Het
Gm128 C T 3: 95,240,567 V139M possibly damaging Het
Gm973 A G 1: 59,526,813 T64A probably damaging Het
Gtf2h5 T A 17: 6,084,628 N64K probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Haus6 A G 4: 86,594,773 S386P possibly damaging Het
Hsh2d A G 8: 72,196,794 probably null Het
Htt T C 5: 34,790,353 M125T possibly damaging Het
Inpp5d T A 1: 87,708,211 probably null Het
Ints4 G A 7: 97,490,972 A137T probably benign Het
Isl2 A G 9: 55,544,352 D263G probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Jpt1 A T 11: 115,498,269 L116Q probably damaging Het
Kansl2 A G 15: 98,531,894 S86P possibly damaging Het
Kat2b G T 17: 53,610,925 R104I possibly damaging Het
Kcna10 C A 3: 107,195,046 A331D probably benign Het
Kcnk3 G A 5: 30,622,331 V242M possibly damaging Het
Kdm4a A G 4: 118,160,243 L542P probably damaging Het
Kif20b T C 19: 34,929,687 F119L probably damaging Het
Krtcap3 A T 5: 31,252,537 H149L probably benign Het
Lhx4 A G 1: 155,710,259 V102A probably damaging Het
Luc7l T A 17: 26,253,182 probably benign Het
Myh15 G T 16: 49,155,537 A1323S possibly damaging Het
Myl1 T A 1: 66,926,179 R151S unknown Het
Naif1 A G 2: 32,452,571 S45G probably benign Het
Ndst4 C T 3: 125,708,151 T121I probably damaging Het
Neurod6 C T 6: 55,679,298 R118Q probably damaging Het
Npl A T 1: 153,537,511 probably null Het
Nr4a3 T C 4: 48,051,476 Y77H probably damaging Het
Olfr1270 T G 2: 90,149,487 D173A probably damaging Het
Pex11a G A 7: 79,742,987 probably benign Het
Rab44 T A 17: 29,140,496 F553I unknown Het
Sbf2 C T 7: 110,365,821 R1002H probably damaging Het
Sectm1a C A 11: 121,069,293 probably null Het
Slit3 G A 11: 35,686,428 V1163M possibly damaging Het
Sphk2 G A 7: 45,711,756 R275C probably damaging Het
Tango6 A G 8: 106,688,834 S96G probably benign Het
Tg A G 15: 66,696,583 E1373G probably damaging Het
Traf3ip1 T A 1: 91,507,736 probably null Het
Trp53 T C 11: 69,588,388 F131L probably damaging Het
Ttc21a A T 9: 119,959,051 E847D probably benign Het
Ttn A G 2: 76,772,447 F18477S probably damaging Het
Usp25 A T 16: 77,113,842 R929* probably null Het
Usp49 G T 17: 47,672,168 E33* probably null Het
Vmn1r63 A G 7: 5,803,555 V26A possibly damaging Het
Vmn1r74 A T 7: 11,847,154 Y127F possibly damaging Het
Wdfy3 C T 5: 101,957,500 V154I probably benign Het
Xdh A G 17: 73,913,965 S590P possibly damaging Het
Zkscan4 A G 13: 21,484,629 K446E probably damaging Het
Other mutations in Olfr1254
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Olfr1254 APN 2 89788785 missense probably damaging 1.00
IGL02822:Olfr1254 APN 2 89789100 missense possibly damaging 0.56
R1166:Olfr1254 UTSW 2 89789331 missense possibly damaging 0.74
R1639:Olfr1254 UTSW 2 89789245 missense probably damaging 1.00
R2248:Olfr1254 UTSW 2 89789180 missense possibly damaging 0.59
R2256:Olfr1254 UTSW 2 89788470 missense probably benign
R2351:Olfr1254 UTSW 2 89789178 missense probably damaging 0.97
R4432:Olfr1254 UTSW 2 89788734 missense possibly damaging 0.76
R4649:Olfr1254 UTSW 2 89789293 missense probably benign 0.19
R4788:Olfr1254 UTSW 2 89789136 missense probably damaging 1.00
R6454:Olfr1254 UTSW 2 89789178 missense probably damaging 0.97
R6591:Olfr1254 UTSW 2 89788988 nonsense probably null
R6691:Olfr1254 UTSW 2 89788988 nonsense probably null
R7451:Olfr1254 UTSW 2 89789109 missense probably benign
R8024:Olfr1254 UTSW 2 89789046 missense probably benign 0.07
R8080:Olfr1254 UTSW 2 89788627 missense possibly damaging 0.78
X0022:Olfr1254 UTSW 2 89788731 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCATCGTTGGCAATGACAG -3'
(R):5'- TGCCTATCTGTCACTCATGGATG -3'

Sequencing Primer
(F):5'- CATCGTTGGCAATGACAGTAAGACC -3'
(R):5'- GGATGCTATTTATTCCACTGCAATC -3'
Posted On2019-10-07