Incidental Mutation 'R7418:Ccdc180'
ID 575437
Institutional Source Beutler Lab
Gene Symbol Ccdc180
Ensembl Gene ENSMUSG00000035539
Gene Name coiled-coil domain containing 180
Synonyms LOC381522, E230008N13Rik
MMRRC Submission 045496-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7418 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 45890303-45950774 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45904616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 404 (L404P)
Ref Sequence ENSEMBL: ENSMUSP00000136714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178561]
AlphaFold J3QNE4
Predicted Effect
SMART Domains Protein: ENSMUSP00000119784
Gene: ENSMUSG00000035539
AA Change: L396P

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
coiled coil region 90 117 N/A INTRINSIC
Pfam:DUF4455 141 609 2e-189 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 658 675 N/A INTRINSIC
coiled coil region 710 780 N/A INTRINSIC
coiled coil region 945 979 N/A INTRINSIC
low complexity region 1100 1123 N/A INTRINSIC
Pfam:DUF4456 1169 1372 9.5e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178561
AA Change: L404P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136714
Gene: ENSMUSG00000035539
AA Change: L404P

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Pfam:DUF4455 148 616 7.3e-189 PFAM
low complexity region 635 649 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
coiled coil region 718 788 N/A INTRINSIC
coiled coil region 1121 1155 N/A INTRINSIC
low complexity region 1275 1298 N/A INTRINSIC
Pfam:DUF4456 1344 1547 2.2e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a coiled-coil domain. Alternative splicing results in multiple transcript variants encoding different isoforms. A single nucleotide polymorphism (SNP) in this gene has been associated with increased susceptibility to Behcet's Disease (PMID: 19442274). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 T G 10: 90,859,697 (GRCm39) H827P probably benign Het
Atp8b3 A T 10: 80,365,926 (GRCm39) L308Q probably damaging Het
Cdh13 G A 8: 120,039,264 (GRCm39) G569R probably damaging Het
Clec14a G A 12: 58,315,433 (GRCm39) T63I probably damaging Het
Cngb1 G T 8: 96,004,887 (GRCm39) S487* probably null Het
Cog5 A T 12: 31,883,240 (GRCm39) N390Y probably damaging Het
Col6a4 C T 9: 105,900,114 (GRCm39) G1670S probably damaging Het
Daxx T A 17: 34,129,579 (GRCm39) D53E probably benign Het
Dnah14 C T 1: 181,444,307 (GRCm39) T539I possibly damaging Het
Dnajc2 A G 5: 21,965,622 (GRCm39) probably null Het
Ehmt1 C T 2: 24,774,646 (GRCm39) G53R probably benign Het
Eif2b1 T A 5: 124,714,893 (GRCm39) N113Y probably benign Het
Eya3 A G 4: 132,408,159 (GRCm39) T152A possibly damaging Het
Fam234b G A 6: 135,194,009 (GRCm39) V221M probably benign Het
Fbxl13 T A 5: 21,786,981 (GRCm39) T319S probably benign Het
Fchsd2 G T 7: 100,920,831 (GRCm39) V479F possibly damaging Het
Fgd5 T C 6: 92,001,519 (GRCm39) S905P probably benign Het
Fthl17b C T X: 8,829,047 (GRCm39) V8M possibly damaging Het
Fthl17b C T X: 8,829,043 (GRCm39) R9Q possibly damaging Het
Fxn C T 19: 24,257,860 (GRCm39) V24I probably benign Het
Gapvd1 C T 2: 34,615,130 (GRCm39) D456N probably benign Het
Gm128 C T 3: 95,147,878 (GRCm39) V139M possibly damaging Het
Gm973 A G 1: 59,565,972 (GRCm39) T64A probably damaging Het
Gtf2h5 T A 17: 6,134,903 (GRCm39) N64K probably damaging Het
H2bw2 G A X: 135,828,471 (GRCm39) R120K unknown Het
Haus6 A G 4: 86,513,010 (GRCm39) S386P possibly damaging Het
Hsh2d A G 8: 72,950,638 (GRCm39) probably null Het
Htt T C 5: 34,947,697 (GRCm39) M125T possibly damaging Het
Inpp5d T A 1: 87,635,933 (GRCm39) probably null Het
Ints4 G A 7: 97,140,179 (GRCm39) A137T probably benign Het
Isl2 A G 9: 55,451,636 (GRCm39) D263G probably benign Het
Itgb5 T G 16: 33,705,464 (GRCm39) D251E probably damaging Het
Jpt1 A T 11: 115,389,095 (GRCm39) L116Q probably damaging Het
Kansl2 A G 15: 98,429,775 (GRCm39) S86P possibly damaging Het
Kat2b G T 17: 53,917,953 (GRCm39) R104I possibly damaging Het
Kcna10 C A 3: 107,102,362 (GRCm39) A331D probably benign Het
Kcnk3 G A 5: 30,779,675 (GRCm39) V242M possibly damaging Het
Kdm4a A G 4: 118,017,440 (GRCm39) L542P probably damaging Het
Kif20b T C 19: 34,907,087 (GRCm39) F119L probably damaging Het
Krtcap3 A T 5: 31,409,881 (GRCm39) H149L probably benign Het
Lhx4 A G 1: 155,586,005 (GRCm39) V102A probably damaging Het
Luc7l T A 17: 26,472,156 (GRCm39) probably benign Het
Myh15 G T 16: 48,975,900 (GRCm39) A1323S possibly damaging Het
Myl1 T A 1: 66,965,338 (GRCm39) R151S unknown Het
Naif1 A G 2: 32,342,583 (GRCm39) S45G probably benign Het
Ndst4 C T 3: 125,501,800 (GRCm39) T121I probably damaging Het
Neurod6 C T 6: 55,656,283 (GRCm39) R118Q probably damaging Het
Npl A T 1: 153,413,257 (GRCm39) probably null Het
Nr4a3 T C 4: 48,051,476 (GRCm39) Y77H probably damaging Het
Or4a81 A T 2: 89,619,320 (GRCm39) C125* probably null Het
Or4b1 T G 2: 89,979,831 (GRCm39) D173A probably damaging Het
Pex11a G A 7: 79,392,735 (GRCm39) probably benign Het
Rab44 T A 17: 29,359,470 (GRCm39) F553I unknown Het
Sbf2 C T 7: 109,965,028 (GRCm39) R1002H probably damaging Het
Sectm1a C A 11: 120,960,119 (GRCm39) probably null Het
Slit3 G A 11: 35,577,255 (GRCm39) V1163M possibly damaging Het
Sphk2 G A 7: 45,361,180 (GRCm39) R275C probably damaging Het
Tango6 A G 8: 107,415,466 (GRCm39) S96G probably benign Het
Tg A G 15: 66,568,432 (GRCm39) E1373G probably damaging Het
Traf3ip1 T A 1: 91,435,458 (GRCm39) probably null Het
Trp53 T C 11: 69,479,214 (GRCm39) F131L probably damaging Het
Ttc21a A T 9: 119,788,117 (GRCm39) E847D probably benign Het
Ttn A G 2: 76,602,791 (GRCm39) F18477S probably damaging Het
Usp25 A T 16: 76,910,730 (GRCm39) R929* probably null Het
Usp49 G T 17: 47,983,093 (GRCm39) E33* probably null Het
Vmn1r63 A G 7: 5,806,554 (GRCm39) V26A possibly damaging Het
Vmn1r74 A T 7: 11,581,081 (GRCm39) Y127F possibly damaging Het
Wdfy3 C T 5: 102,105,366 (GRCm39) V154I probably benign Het
Xdh A G 17: 74,220,960 (GRCm39) S590P possibly damaging Het
Zkscan4 A G 13: 21,668,799 (GRCm39) K446E probably damaging Het
Other mutations in Ccdc180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Ccdc180 APN 4 45,900,256 (GRCm39) missense probably benign
IGL01713:Ccdc180 APN 4 45,921,025 (GRCm39) critical splice donor site probably null
IGL01915:Ccdc180 APN 4 45,904,544 (GRCm39) missense probably damaging 0.98
IGL01935:Ccdc180 APN 4 45,906,889 (GRCm39) missense possibly damaging 0.71
IGL02539:Ccdc180 APN 4 45,921,005 (GRCm39) missense probably damaging 1.00
IGL02982:Ccdc180 APN 4 45,903,840 (GRCm39) splice site probably benign
IGL03071:Ccdc180 APN 4 45,903,840 (GRCm39) splice site probably benign
IGL03146:Ccdc180 APN 4 45,903,840 (GRCm39) splice site probably benign
PIT4687001:Ccdc180 UTSW 4 45,949,526 (GRCm39) missense probably damaging 1.00
R0049:Ccdc180 UTSW 4 45,930,119 (GRCm39) critical splice acceptor site probably null
R0049:Ccdc180 UTSW 4 45,930,119 (GRCm39) critical splice acceptor site probably null
R0054:Ccdc180 UTSW 4 45,890,900 (GRCm39) missense probably benign 0.01
R0054:Ccdc180 UTSW 4 45,890,900 (GRCm39) missense probably benign 0.01
R0080:Ccdc180 UTSW 4 45,896,205 (GRCm39) missense probably null 0.00
R0082:Ccdc180 UTSW 4 45,896,205 (GRCm39) missense probably null 0.00
R0126:Ccdc180 UTSW 4 45,912,866 (GRCm39) critical splice donor site probably null
R0193:Ccdc180 UTSW 4 45,914,803 (GRCm39) missense probably benign 0.01
R0276:Ccdc180 UTSW 4 45,923,534 (GRCm39) missense probably damaging 1.00
R0362:Ccdc180 UTSW 4 45,923,551 (GRCm39) missense probably damaging 1.00
R0380:Ccdc180 UTSW 4 45,930,197 (GRCm39) critical splice donor site probably null
R0468:Ccdc180 UTSW 4 45,923,271 (GRCm39) missense possibly damaging 0.87
R0539:Ccdc180 UTSW 4 45,922,010 (GRCm39) missense probably damaging 0.97
R0543:Ccdc180 UTSW 4 45,900,041 (GRCm39) nonsense probably null
R0546:Ccdc180 UTSW 4 45,904,597 (GRCm39) missense possibly damaging 0.71
R0612:Ccdc180 UTSW 4 45,927,969 (GRCm39) missense probably damaging 0.98
R0792:Ccdc180 UTSW 4 45,927,975 (GRCm39) missense possibly damaging 0.92
R1056:Ccdc180 UTSW 4 45,916,375 (GRCm39) missense probably benign 0.01
R1099:Ccdc180 UTSW 4 45,914,225 (GRCm39) missense probably benign 0.03
R1136:Ccdc180 UTSW 4 45,914,589 (GRCm39) missense probably benign 0.00
R1263:Ccdc180 UTSW 4 45,903,887 (GRCm39) missense possibly damaging 0.85
R1331:Ccdc180 UTSW 4 45,909,359 (GRCm39) missense possibly damaging 0.51
R1522:Ccdc180 UTSW 4 45,927,975 (GRCm39) missense possibly damaging 0.92
R1819:Ccdc180 UTSW 4 45,926,195 (GRCm39) missense possibly damaging 0.84
R2022:Ccdc180 UTSW 4 45,944,418 (GRCm39) missense probably benign 0.18
R2056:Ccdc180 UTSW 4 45,932,477 (GRCm39) missense probably benign 0.03
R2219:Ccdc180 UTSW 4 45,944,949 (GRCm39) missense probably damaging 1.00
R2228:Ccdc180 UTSW 4 45,948,856 (GRCm39) critical splice donor site probably null
R2229:Ccdc180 UTSW 4 45,948,856 (GRCm39) critical splice donor site probably null
R2255:Ccdc180 UTSW 4 45,921,996 (GRCm39) missense probably damaging 1.00
R2427:Ccdc180 UTSW 4 45,929,545 (GRCm39) missense probably benign 0.03
R3001:Ccdc180 UTSW 4 45,899,988 (GRCm39) missense probably benign
R3002:Ccdc180 UTSW 4 45,899,988 (GRCm39) missense probably benign
R3003:Ccdc180 UTSW 4 45,899,988 (GRCm39) missense probably benign
R3110:Ccdc180 UTSW 4 45,900,470 (GRCm39) missense possibly damaging 0.86
R3111:Ccdc180 UTSW 4 45,900,470 (GRCm39) missense possibly damaging 0.86
R3112:Ccdc180 UTSW 4 45,900,470 (GRCm39) missense possibly damaging 0.86
R3898:Ccdc180 UTSW 4 45,912,799 (GRCm39) missense possibly damaging 0.71
R4022:Ccdc180 UTSW 4 45,904,560 (GRCm39) nonsense probably null
R4084:Ccdc180 UTSW 4 45,950,632 (GRCm39) missense probably benign 0.19
R4377:Ccdc180 UTSW 4 45,941,877 (GRCm39) missense probably damaging 1.00
R4595:Ccdc180 UTSW 4 45,945,023 (GRCm39) missense probably damaging 0.98
R4637:Ccdc180 UTSW 4 45,914,443 (GRCm39) missense probably benign
R4811:Ccdc180 UTSW 4 45,928,020 (GRCm39) missense probably damaging 1.00
R4825:Ccdc180 UTSW 4 45,912,794 (GRCm39) missense possibly damaging 0.93
R4858:Ccdc180 UTSW 4 45,923,244 (GRCm39) missense probably damaging 1.00
R4888:Ccdc180 UTSW 4 45,909,308 (GRCm39) missense probably damaging 0.98
R4940:Ccdc180 UTSW 4 45,917,508 (GRCm39) missense probably damaging 1.00
R4940:Ccdc180 UTSW 4 45,917,453 (GRCm39) missense probably damaging 0.96
R5042:Ccdc180 UTSW 4 45,916,255 (GRCm39) missense probably damaging 0.98
R5119:Ccdc180 UTSW 4 45,914,603 (GRCm39) missense possibly damaging 0.72
R5177:Ccdc180 UTSW 4 45,917,508 (GRCm39) missense probably damaging 1.00
R5311:Ccdc180 UTSW 4 45,917,556 (GRCm39) missense probably damaging 1.00
R5333:Ccdc180 UTSW 4 45,890,935 (GRCm39) missense possibly damaging 0.53
R5448:Ccdc180 UTSW 4 45,920,913 (GRCm39) missense probably damaging 1.00
R5510:Ccdc180 UTSW 4 45,928,046 (GRCm39) missense probably damaging 0.96
R6018:Ccdc180 UTSW 4 45,926,235 (GRCm39) missense probably damaging 1.00
R6108:Ccdc180 UTSW 4 45,911,389 (GRCm39) missense possibly damaging 0.71
R6283:Ccdc180 UTSW 4 45,902,486 (GRCm39) missense possibly damaging 0.85
R6483:Ccdc180 UTSW 4 45,921,950 (GRCm39) missense probably benign 0.32
R6618:Ccdc180 UTSW 4 45,950,708 (GRCm39) missense probably damaging 1.00
R7017:Ccdc180 UTSW 4 45,940,934 (GRCm39) missense possibly damaging 0.84
R7205:Ccdc180 UTSW 4 45,914,588 (GRCm39) missense probably benign
R7341:Ccdc180 UTSW 4 45,898,644 (GRCm39) missense possibly damaging 0.85
R7351:Ccdc180 UTSW 4 45,903,887 (GRCm39) missense possibly damaging 0.85
R7492:Ccdc180 UTSW 4 45,930,009 (GRCm39) splice site probably null
R7573:Ccdc180 UTSW 4 45,922,015 (GRCm39) missense probably benign 0.33
R7639:Ccdc180 UTSW 4 45,928,043 (GRCm39) missense possibly damaging 0.93
R7792:Ccdc180 UTSW 4 45,890,389 (GRCm39) critical splice donor site probably null
R7806:Ccdc180 UTSW 4 45,912,801 (GRCm39) missense possibly damaging 0.85
R7812:Ccdc180 UTSW 4 45,906,952 (GRCm39) critical splice donor site probably null
R7840:Ccdc180 UTSW 4 45,900,461 (GRCm39) missense possibly damaging 0.71
R7842:Ccdc180 UTSW 4 45,909,428 (GRCm39) missense probably benign 0.00
R8712:Ccdc180 UTSW 4 45,920,842 (GRCm39) critical splice acceptor site probably null
R8818:Ccdc180 UTSW 4 45,900,484 (GRCm39) missense probably benign 0.02
R8961:Ccdc180 UTSW 4 45,929,573 (GRCm39) missense possibly damaging 0.74
R8983:Ccdc180 UTSW 4 45,909,359 (GRCm39) missense possibly damaging 0.93
R9035:Ccdc180 UTSW 4 45,906,922 (GRCm39) nonsense probably null
R9095:Ccdc180 UTSW 4 45,949,466 (GRCm39) nonsense probably null
R9240:Ccdc180 UTSW 4 45,917,566 (GRCm39) critical splice donor site probably null
R9293:Ccdc180 UTSW 4 45,944,461 (GRCm39) missense probably damaging 1.00
R9328:Ccdc180 UTSW 4 45,902,447 (GRCm39) missense possibly damaging 0.71
R9346:Ccdc180 UTSW 4 45,927,953 (GRCm39) missense probably benign 0.09
R9521:Ccdc180 UTSW 4 45,916,283 (GRCm39) missense probably null 0.50
R9653:Ccdc180 UTSW 4 45,923,495 (GRCm39) missense probably damaging 0.99
R9667:Ccdc180 UTSW 4 45,920,861 (GRCm39) nonsense probably null
X0017:Ccdc180 UTSW 4 45,909,350 (GRCm39) missense possibly damaging 0.86
Z1176:Ccdc180 UTSW 4 45,920,910 (GRCm39) missense probably damaging 1.00
Z1176:Ccdc180 UTSW 4 45,916,406 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAATGAAAGGCCTTTTGGTGAGG -3'
(R):5'- GCTAGCATGGCTGTGAACTG -3'

Sequencing Primer
(F):5'- GGAGACCCCAACAGTTTCTTTAG -3'
(R):5'- CTGTGAACTGGGCAGTGAGC -3'
Posted On 2019-10-07