Mutagenetix > Incidental Mutation

Incidental Mutation 'R7418:Ccdc180'

575437

Institutional Source

Beutler Lab

Gene Symbol

Ccdc180

Ensembl Gene

ENSMUSG00000035539

Gene Name

coiled-coil domain containing 180

Synonyms

E230008N13Rik, LOC381522

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7418 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45890303-45950774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 45904616 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 404 (L404P)

Ref Sequence

ENSEMBL: ENSMUSP00000136714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000178561]

AlphaFold

J3QNE4

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119784
Gene: ENSMUSG00000035539
AA Change: L396P

Domain	Start	End	E-Value	Type
low complexity region	25	42	N/A	INTRINSIC
coiled coil region	90	117	N/A	INTRINSIC
Pfam:DUF4455	141	609	2e-189	PFAM
low complexity region	628	642	N/A	INTRINSIC
low complexity region	658	675	N/A	INTRINSIC
coiled coil region	710	780	N/A	INTRINSIC
coiled coil region	945	979	N/A	INTRINSIC
low complexity region	1100	1123	N/A	INTRINSIC
Pfam:DUF4456	1169	1372	9.5e-77	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000178561
AA Change: L404P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000136714
Gene: ENSMUSG00000035539
AA Change: L404P

Domain	Start	End	E-Value	Type
low complexity region	32	49	N/A	INTRINSIC
coiled coil region	98	125	N/A	INTRINSIC
Pfam:DUF4455	148	616	7.3e-189	PFAM
low complexity region	635	649	N/A	INTRINSIC
low complexity region	665	682	N/A	INTRINSIC
coiled coil region	718	788	N/A	INTRINSIC
coiled coil region	1121	1155	N/A	INTRINSIC
low complexity region	1275	1298	N/A	INTRINSIC
Pfam:DUF4456	1344	1547	2.2e-76	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (66/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a coiled-coil domain. Alternative splicing results in multiple transcript variants encoding different isoforms. A single nucleotide polymorphism (SNP) in this gene has been associated with increased susceptibility to Behcet's Disease (PMID: 19442274). [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apaf1	T	G	10: 91,023,835	H827P	probably benign	Het
Atp8b3	A	T	10: 80,530,092	L308Q	probably damaging	Het
Cdh13	G	A	8: 119,312,525	G569R	probably damaging	Het
Clec14a	G	A	12: 58,268,647	T63I	probably damaging	Het
Cngb1	G	T	8: 95,278,259	S487*	probably null	Het
Cog5	A	T	12: 31,833,241	N390Y	probably damaging	Het
Col6a4	C	T	9: 106,022,915	G1670S	probably damaging	Het
Daxx	T	A	17: 33,910,605	D53E	probably benign	Het
Dnah14	C	T	1: 181,616,742	T539I	possibly damaging	Het
Dnajc2	A	G	5: 21,760,624		probably null	Het
Ehmt1	C	T	2: 24,884,634	G53R	probably benign	Het
Eif2b1	T	A	5: 124,576,830	N113Y	probably benign	Het
Eya3	A	G	4: 132,680,848	T152A	possibly damaging	Het
Fam234b	G	A	6: 135,217,011	V221M	probably benign	Het
Fbxl13	T	A	5: 21,581,983	T319S	probably benign	Het
Fchsd2	G	T	7: 101,271,624	V479F	possibly damaging	Het
Fgd5	T	C	6: 92,024,538	S905P	probably benign	Het
Fthl17b	C	T	X: 8,962,804	R9Q	possibly damaging	Het
Fthl17b	C	T	X: 8,962,808	V8M	possibly damaging	Het
Fxn	C	T	19: 24,280,496	V24I	probably benign	Het
Gapvd1	C	T	2: 34,725,118	D456N	probably benign	Het
Gm128	C	T	3: 95,240,567	V139M	possibly damaging	Het
Gm973	A	G	1: 59,526,813	T64A	probably damaging	Het
Gtf2h5	T	A	17: 6,084,628	N64K	probably damaging	Het
H2bfm	G	A	X: 136,927,722	R120K	unknown	Het
Haus6	A	G	4: 86,594,773	S386P	possibly damaging	Het
Hsh2d	A	G	8: 72,196,794		probably null	Het
Htt	T	C	5: 34,790,353	M125T	possibly damaging	Het
Inpp5d	T	A	1: 87,708,211		probably null	Het
Ints4	G	A	7: 97,490,972	A137T	probably benign	Het
Isl2	A	G	9: 55,544,352	D263G	probably benign	Het
Itgb5	T	G	16: 33,885,094	D251E	probably damaging	Het
Jpt1	A	T	11: 115,498,269	L116Q	probably damaging	Het
Kansl2	A	G	15: 98,531,894	S86P	possibly damaging	Het
Kat2b	G	T	17: 53,610,925	R104I	possibly damaging	Het
Kcna10	C	A	3: 107,195,046	A331D	probably benign	Het
Kcnk3	G	A	5: 30,622,331	V242M	possibly damaging	Het
Kdm4a	A	G	4: 118,160,243	L542P	probably damaging	Het
Kif20b	T	C	19: 34,929,687	F119L	probably damaging	Het
Krtcap3	A	T	5: 31,252,537	H149L	probably benign	Het
Lhx4	A	G	1: 155,710,259	V102A	probably damaging	Het
Luc7l	T	A	17: 26,253,182		probably benign	Het
Myh15	G	T	16: 49,155,537	A1323S	possibly damaging	Het
Myl1	T	A	1: 66,926,179	R151S	unknown	Het
Naif1	A	G	2: 32,452,571	S45G	probably benign	Het
Ndst4	C	T	3: 125,708,151	T121I	probably damaging	Het
Neurod6	C	T	6: 55,679,298	R118Q	probably damaging	Het
Npl	A	T	1: 153,537,511		probably null	Het
Nr4a3	T	C	4: 48,051,476	Y77H	probably damaging	Het
Olfr1254	A	T	2: 89,788,976	C125*	probably null	Het
Olfr1270	T	G	2: 90,149,487	D173A	probably damaging	Het
Pex11a	G	A	7: 79,742,987		probably benign	Het
Rab44	T	A	17: 29,140,496	F553I	unknown	Het
Sbf2	C	T	7: 110,365,821	R1002H	probably damaging	Het
Sectm1a	C	A	11: 121,069,293		probably null	Het
Slit3	G	A	11: 35,686,428	V1163M	possibly damaging	Het
Sphk2	G	A	7: 45,711,756	R275C	probably damaging	Het
Tango6	A	G	8: 106,688,834	S96G	probably benign	Het
Tg	A	G	15: 66,696,583	E1373G	probably damaging	Het
Traf3ip1	T	A	1: 91,507,736		probably null	Het
Trp53	T	C	11: 69,588,388	F131L	probably damaging	Het
Ttc21a	A	T	9: 119,959,051	E847D	probably benign	Het
Ttn	A	G	2: 76,772,447	F18477S	probably damaging	Het
Usp25	A	T	16: 77,113,842	R929*	probably null	Het
Usp49	G	T	17: 47,672,168	E33*	probably null	Het
Vmn1r63	A	G	7: 5,803,555	V26A	possibly damaging	Het
Vmn1r74	A	T	7: 11,847,154	Y127F	possibly damaging	Het
Wdfy3	C	T	5: 101,957,500	V154I	probably benign	Het
Xdh	A	G	17: 73,913,965	S590P	possibly damaging	Het
Zkscan4	A	G	13: 21,484,629	K446E	probably damaging	Het

Other mutations in Ccdc180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01369:Ccdc180	APN	4	45900256	missense	probably benign
IGL01713:Ccdc180	APN	4	45921025	critical splice donor site	probably null
IGL01915:Ccdc180	APN	4	45904544	missense	probably damaging	0.98
IGL01935:Ccdc180	APN	4	45906889	missense	possibly damaging	0.71
IGL02539:Ccdc180	APN	4	45921005	missense	probably damaging	1.00
IGL02982:Ccdc180	APN	4	45903840	splice site	probably benign
IGL03071:Ccdc180	APN	4	45903840	splice site	probably benign
IGL03146:Ccdc180	APN	4	45903840	splice site	probably benign
PIT4687001:Ccdc180	UTSW	4	45949526	missense	probably damaging	1.00
R0049:Ccdc180	UTSW	4	45930119	critical splice acceptor site	probably null
R0049:Ccdc180	UTSW	4	45930119	critical splice acceptor site	probably null
R0054:Ccdc180	UTSW	4	45890900	missense	probably benign	0.01
R0054:Ccdc180	UTSW	4	45890900	missense	probably benign	0.01
R0080:Ccdc180	UTSW	4	45896205	missense	probably null	0.00
R0082:Ccdc180	UTSW	4	45896205	missense	probably null	0.00
R0126:Ccdc180	UTSW	4	45912866	critical splice donor site	probably null
R0193:Ccdc180	UTSW	4	45914803	missense	probably benign	0.01
R0276:Ccdc180	UTSW	4	45923534	missense	probably damaging	1.00
R0362:Ccdc180	UTSW	4	45923551	missense	probably damaging	1.00
R0380:Ccdc180	UTSW	4	45930197	critical splice donor site	probably null
R0468:Ccdc180	UTSW	4	45923271	missense	possibly damaging	0.87
R0539:Ccdc180	UTSW	4	45922010	missense	probably damaging	0.97
R0543:Ccdc180	UTSW	4	45900041	nonsense	probably null
R0546:Ccdc180	UTSW	4	45904597	missense	possibly damaging	0.71
R0612:Ccdc180	UTSW	4	45927969	missense	probably damaging	0.98
R0792:Ccdc180	UTSW	4	45927975	missense	possibly damaging	0.92
R1056:Ccdc180	UTSW	4	45916375	missense	probably benign	0.01
R1099:Ccdc180	UTSW	4	45914225	missense	probably benign	0.03
R1136:Ccdc180	UTSW	4	45914589	missense	probably benign	0.00
R1263:Ccdc180	UTSW	4	45903887	missense	possibly damaging	0.85
R1331:Ccdc180	UTSW	4	45909359	missense	possibly damaging	0.51
R1522:Ccdc180	UTSW	4	45927975	missense	possibly damaging	0.92
R1819:Ccdc180	UTSW	4	45926195	missense	possibly damaging	0.84
R2022:Ccdc180	UTSW	4	45944418	missense	probably benign	0.18
R2056:Ccdc180	UTSW	4	45932477	missense	probably benign	0.03
R2219:Ccdc180	UTSW	4	45944949	missense	probably damaging	1.00
R2228:Ccdc180	UTSW	4	45948856	critical splice donor site	probably null
R2229:Ccdc180	UTSW	4	45948856	critical splice donor site	probably null
R2255:Ccdc180	UTSW	4	45921996	missense	probably damaging	1.00
R2427:Ccdc180	UTSW	4	45929545	missense	probably benign	0.03
R3001:Ccdc180	UTSW	4	45899988	missense	probably benign
R3002:Ccdc180	UTSW	4	45899988	missense	probably benign
R3003:Ccdc180	UTSW	4	45899988	missense	probably benign
R3110:Ccdc180	UTSW	4	45900470	missense	possibly damaging	0.86
R3111:Ccdc180	UTSW	4	45900470	missense	possibly damaging	0.86
R3112:Ccdc180	UTSW	4	45900470	missense	possibly damaging	0.86
R3898:Ccdc180	UTSW	4	45912799	missense	possibly damaging	0.71
R4022:Ccdc180	UTSW	4	45904560	nonsense	probably null
R4084:Ccdc180	UTSW	4	45950632	missense	probably benign	0.19
R4377:Ccdc180	UTSW	4	45941877	missense	probably damaging	1.00
R4595:Ccdc180	UTSW	4	45945023	missense	probably damaging	0.98
R4637:Ccdc180	UTSW	4	45914443	missense	probably benign
R4811:Ccdc180	UTSW	4	45928020	missense	probably damaging	1.00
R4825:Ccdc180	UTSW	4	45912794	missense	possibly damaging	0.93
R4858:Ccdc180	UTSW	4	45923244	missense	probably damaging	1.00
R4888:Ccdc180	UTSW	4	45909308	missense	probably damaging	0.98
R4940:Ccdc180	UTSW	4	45917453	missense	probably damaging	0.96
R4940:Ccdc180	UTSW	4	45917508	missense	probably damaging	1.00
R5042:Ccdc180	UTSW	4	45916255	missense	probably damaging	0.98
R5119:Ccdc180	UTSW	4	45914603	missense	possibly damaging	0.72
R5177:Ccdc180	UTSW	4	45917508	missense	probably damaging	1.00
R5311:Ccdc180	UTSW	4	45917556	missense	probably damaging	1.00
R5333:Ccdc180	UTSW	4	45890935	missense	possibly damaging	0.53
R5448:Ccdc180	UTSW	4	45920913	missense	probably damaging	1.00
R5510:Ccdc180	UTSW	4	45928046	missense	probably damaging	0.96
R6018:Ccdc180	UTSW	4	45926235	missense	probably damaging	1.00
R6108:Ccdc180	UTSW	4	45911389	missense	possibly damaging	0.71
R6283:Ccdc180	UTSW	4	45902486	missense	possibly damaging	0.85
R6483:Ccdc180	UTSW	4	45921950	missense	probably benign	0.32
R6618:Ccdc180	UTSW	4	45950708	missense	probably damaging	1.00
R7017:Ccdc180	UTSW	4	45940934	missense	possibly damaging	0.84
R7205:Ccdc180	UTSW	4	45914588	missense	probably benign
R7341:Ccdc180	UTSW	4	45898644	missense	possibly damaging	0.85
R7351:Ccdc180	UTSW	4	45903887	missense	possibly damaging	0.85
R7492:Ccdc180	UTSW	4	45930009	splice site	probably null
R7573:Ccdc180	UTSW	4	45922015	missense	probably benign	0.33
R7639:Ccdc180	UTSW	4	45928043	missense	possibly damaging	0.93
R7792:Ccdc180	UTSW	4	45890389	critical splice donor site	probably null
R7806:Ccdc180	UTSW	4	45912801	missense	possibly damaging	0.85
R7812:Ccdc180	UTSW	4	45906952	critical splice donor site	probably null
R7840:Ccdc180	UTSW	4	45900461	missense	possibly damaging	0.71
R7842:Ccdc180	UTSW	4	45909428	missense	probably benign	0.00
R8712:Ccdc180	UTSW	4	45920842	critical splice acceptor site	probably null
R8818:Ccdc180	UTSW	4	45900484	missense	probably benign	0.02
R8961:Ccdc180	UTSW	4	45929573	missense	possibly damaging	0.74
R8983:Ccdc180	UTSW	4	45909359	missense	possibly damaging	0.93
R9035:Ccdc180	UTSW	4	45906922	nonsense	probably null
R9095:Ccdc180	UTSW	4	45949466	nonsense	probably null
R9240:Ccdc180	UTSW	4	45917566	critical splice donor site	probably null
R9293:Ccdc180	UTSW	4	45944461	missense	probably damaging	1.00
R9328:Ccdc180	UTSW	4	45902447	missense	possibly damaging	0.71
R9346:Ccdc180	UTSW	4	45927953	missense	probably benign	0.09
R9521:Ccdc180	UTSW	4	45916283	missense	probably null	0.50
X0017:Ccdc180	UTSW	4	45909350	missense	possibly damaging	0.86
Z1176:Ccdc180	UTSW	4	45916406	missense	probably damaging	1.00
Z1176:Ccdc180	UTSW	4	45920910	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATAATGAAAGGCCTTTTGGTGAGG -3'
(R):5'- GCTAGCATGGCTGTGAACTG -3'

Sequencing Primer
(F):5'- GGAGACCCCAACAGTTTCTTTAG -3'
(R):5'- CTGTGAACTGGGCAGTGAGC -3'

Posted On

2019-10-07