Mutagenetix > Incidental Mutations

Incidental Mutation 'R7418:Haus6'

575439

Institutional Source

Beutler Lab

Gene Symbol

Haus6

Ensembl Gene

ENSMUSG00000038047

Gene Name

HAUS augmin-like complex, subunit 6

Synonyms

6230416J20Rik, D4Ertd27e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.629) question?

Stock #

R7418 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86578855-86612055 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86594773 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 386 (S386P)

Ref Sequence

ENSEMBL: ENSMUSP00000070504 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070607]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070607
AA Change: S386P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000070504
Gene: ENSMUSG00000038047
AA Change: S386P

Domain	Start	End	E-Value	Type
Pfam:HAUS6_N	14	238	1.1e-77	PFAM
low complexity region	613	624	N/A	INTRINSIC
low complexity region	771	785	N/A	INTRINSIC
low complexity region	915	927	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (66/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. This protein may have a role in efficient chromosome congression and segregation by promoting microtubule-dependent microtubule amplification. Pseudogenes of this gene are located on chromosomes 7 and 20. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E2.5 and E7.5 with delayed or incomplete clustering of microtubule-organizing centers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apaf1	T	G	10: 91,023,835	H827P	probably benign	Het
Atp8b3	A	T	10: 80,530,092	L308Q	probably damaging	Het
Ccdc180	T	C	4: 45,904,616	L404P	probably damaging	Het
Cdh13	G	A	8: 119,312,525	G569R	probably damaging	Het
Clec14a	G	A	12: 58,268,647	T63I	probably damaging	Het
Cngb1	G	T	8: 95,278,259	S487*	probably null	Het
Cog5	A	T	12: 31,833,241	N390Y	probably damaging	Het
Col6a4	C	T	9: 106,022,915	G1670S	probably damaging	Het
Daxx	T	A	17: 33,910,605	D53E	probably benign	Het
Dnah14	C	T	1: 181,616,742	T539I	possibly damaging	Het
Dnajc2	A	G	5: 21,760,624		probably null	Het
Ehmt1	C	T	2: 24,884,634	G53R	probably benign	Het
Eif2b1	T	A	5: 124,576,830	N113Y	probably benign	Het
Eya3	A	G	4: 132,680,848	T152A	possibly damaging	Het
Fam234b	G	A	6: 135,217,011	V221M	probably benign	Het
Fbxl13	T	A	5: 21,581,983	T319S	probably benign	Het
Fchsd2	G	T	7: 101,271,624	V479F	possibly damaging	Het
Fgd5	T	C	6: 92,024,538	S905P	probably benign	Het
Fthl17b	C	T	X: 8,962,804	R9Q	possibly damaging	Het
Fthl17b	C	T	X: 8,962,808	V8M	possibly damaging	Het
Fxn	C	T	19: 24,280,496	V24I	probably benign	Het
Gapvd1	C	T	2: 34,725,118	D456N	probably benign	Het
Gm128	C	T	3: 95,240,567	V139M	possibly damaging	Het
Gm973	A	G	1: 59,526,813	T64A	probably damaging	Het
Gtf2h5	T	A	17: 6,084,628	N64K	probably damaging	Het
H2bfm	G	A	X: 136,927,722	R120K	unknown	Het
Hsh2d	A	G	8: 72,196,794		probably null	Het
Htt	T	C	5: 34,790,353	M125T	possibly damaging	Het
Inpp5d	T	A	1: 87,708,211		probably null	Het
Ints4	G	A	7: 97,490,972	A137T	probably benign	Het
Isl2	A	G	9: 55,544,352	D263G	probably benign	Het
Itgb5	T	G	16: 33,885,094	D251E	probably damaging	Het
Jpt1	A	T	11: 115,498,269	L116Q	probably damaging	Het
Kansl2	A	G	15: 98,531,894	S86P	possibly damaging	Het
Kat2b	G	T	17: 53,610,925	R104I	possibly damaging	Het
Kcna10	C	A	3: 107,195,046	A331D	probably benign	Het
Kcnk3	G	A	5: 30,622,331	V242M	possibly damaging	Het
Kdm4a	A	G	4: 118,160,243	L542P	probably damaging	Het
Kif20b	T	C	19: 34,929,687	F119L	probably damaging	Het
Krtcap3	A	T	5: 31,252,537	H149L	probably benign	Het
Lhx4	A	G	1: 155,710,259	V102A	probably damaging	Het
Luc7l	T	A	17: 26,253,182		probably benign	Het
Myh15	G	T	16: 49,155,537	A1323S	possibly damaging	Het
Myl1	T	A	1: 66,926,179	R151S	unknown	Het
Naif1	A	G	2: 32,452,571	S45G	probably benign	Het
Ndst4	C	T	3: 125,708,151	T121I	probably damaging	Het
Neurod6	C	T	6: 55,679,298	R118Q	probably damaging	Het
Npl	A	T	1: 153,537,511		probably null	Het
Nr4a3	T	C	4: 48,051,476	Y77H	probably damaging	Het
Olfr1254	A	T	2: 89,788,976	C125*	probably null	Het
Olfr1270	T	G	2: 90,149,487	D173A	probably damaging	Het
Pex11a	G	A	7: 79,742,987		probably benign	Het
Rab44	T	A	17: 29,140,496	F553I	unknown	Het
Sbf2	C	T	7: 110,365,821	R1002H	probably damaging	Het
Sectm1a	C	A	11: 121,069,293		probably null	Het
Slit3	G	A	11: 35,686,428	V1163M	possibly damaging	Het
Sphk2	G	A	7: 45,711,756	R275C	probably damaging	Het
Tango6	A	G	8: 106,688,834	S96G	probably benign	Het
Tg	A	G	15: 66,696,583	E1373G	probably damaging	Het
Traf3ip1	T	A	1: 91,507,736		probably null	Het
Trp53	T	C	11: 69,588,388	F131L	probably damaging	Het
Ttc21a	A	T	9: 119,959,051	E847D	probably benign	Het
Ttn	A	G	2: 76,772,447	F18477S	probably damaging	Het
Usp25	A	T	16: 77,113,842	R929*	probably null	Het
Usp49	G	T	17: 47,672,168	E33*	probably null	Het
Vmn1r63	A	G	7: 5,803,555	V26A	possibly damaging	Het
Vmn1r74	A	T	7: 11,847,154	Y127F	possibly damaging	Het
Wdfy3	C	T	5: 101,957,500	V154I	probably benign	Het
Xdh	A	G	17: 73,913,965	S590P	possibly damaging	Het
Zkscan4	A	G	13: 21,484,629	K446E	probably damaging	Het

Other mutations in Haus6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Haus6	APN	4	86607981	missense	probably benign	0.32
IGL02307:Haus6	APN	4	86583835	missense	possibly damaging	0.53
IGL03113:Haus6	APN	4	86583106	nonsense	probably null
IGL03384:Haus6	APN	4	86583525	missense	probably benign
R0436:Haus6	UTSW	4	86585807	missense	probably benign	0.00
R0491:Haus6	UTSW	4	86602846	missense	possibly damaging	0.93
R0620:Haus6	UTSW	4	86583514	missense	possibly damaging	0.53
R1118:Haus6	UTSW	4	86585326	critical splice donor site	probably null
R1969:Haus6	UTSW	4	86604246	missense	probably damaging	0.99
R1985:Haus6	UTSW	4	86593609	missense	possibly damaging	0.96
R2213:Haus6	UTSW	4	86581992	missense	possibly damaging	0.53
R2448:Haus6	UTSW	4	86589001	missense	possibly damaging	0.53
R2567:Haus6	UTSW	4	86585885	nonsense	probably null
R2760:Haus6	UTSW	4	86583176	nonsense	probably null
R3714:Haus6	UTSW	4	86602867	missense	probably benign	0.01
R3962:Haus6	UTSW	4	86611804	missense	possibly damaging	0.85
R4180:Haus6	UTSW	4	86583574	missense	probably benign	0.00
R4736:Haus6	UTSW	4	86600749	critical splice donor site	probably null
R4738:Haus6	UTSW	4	86600749	critical splice donor site	probably null
R4929:Haus6	UTSW	4	86595433	missense	probably benign	0.03
R4933:Haus6	UTSW	4	86585287	intron	probably benign
R5027:Haus6	UTSW	4	86605696	missense	possibly damaging	0.92
R5199:Haus6	UTSW	4	86582985	missense	possibly damaging	0.85
R5240:Haus6	UTSW	4	86583178	missense	possibly damaging	0.86
R5580:Haus6	UTSW	4	86599266	missense	possibly damaging	0.73
R5781:Haus6	UTSW	4	86601263	missense	possibly damaging	0.92
R5865:Haus6	UTSW	4	86586357	missense	possibly damaging	0.73
R5926:Haus6	UTSW	4	86599316	missense	probably benign
R6154:Haus6	UTSW	4	86583756	missense	possibly damaging	0.96
R7166:Haus6	UTSW	4	86583687	missense	possibly damaging	0.72
R7183:Haus6	UTSW	4	86583752	missense	possibly damaging	0.53
R7843:Haus6	UTSW	4	86586341	missense	possibly damaging	0.85
R7926:Haus6	UTSW	4	86586341	missense	possibly damaging	0.85
Z1088:Haus6	UTSW	4	86602874	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- CATTCACATGCACCATGGCA -3'
(R):5'- CTCTGCCCTGTACTGTTGTTTAAAA -3'

Sequencing Primer
(F):5'- TGGCACATGCAAGCTGC -3'
(R):5'- GCCCTGTACTGTTGTTTAAAATTATG -3'

Posted On

2019-10-07