Incidental Mutation 'R7418:Fgd5'
ID575450
Institutional Source Beutler Lab
Gene Symbol Fgd5
Ensembl Gene ENSMUSG00000034037
Gene NameFYVE, RhoGEF and PH domain containing 5
SynonymsC330025N11Rik, ZFYVE23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R7418 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location91978878-92076004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92024538 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 905 (S905P)
Ref Sequence ENSEMBL: ENSMUSP00000086748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089334] [ENSMUST00000113466]
Predicted Effect probably benign
Transcript: ENSMUST00000089334
AA Change: S905P

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000086748
Gene: ENSMUSG00000034037
AA Change: S905P

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
internal_repeat_1 126 169 2.6e-7 PROSPERO
internal_repeat_1 164 198 2.6e-7 PROSPERO
low complexity region 201 222 N/A INTRINSIC
low complexity region 254 269 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 426 442 N/A INTRINSIC
low complexity region 453 475 N/A INTRINSIC
low complexity region 652 663 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
low complexity region 727 736 N/A INTRINSIC
low complexity region 879 894 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Pfam:RhoGEF 946 1134 2.2e-28 PFAM
PH 1165 1260 4.93e-13 SMART
FYVE 1285 1353 2.51e-16 SMART
low complexity region 1368 1390 N/A INTRINSIC
PH 1416 1514 2.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113466
AA Change: S747P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109093
Gene: ENSMUSG00000034037
AA Change: S747P

DomainStartEndE-ValueType
low complexity region 43 64 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 537 547 N/A INTRINSIC
low complexity region 569 578 N/A INTRINSIC
low complexity region 721 736 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
Pfam:RhoGEF 788 976 1.6e-27 PFAM
PH 1007 1102 4.93e-13 SMART
FYVE 1127 1195 2.51e-16 SMART
low complexity region 1210 1232 N/A INTRINSIC
PH 1258 1356 2.77e-7 SMART
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 T G 10: 91,023,835 H827P probably benign Het
Atp8b3 A T 10: 80,530,092 L308Q probably damaging Het
Ccdc180 T C 4: 45,904,616 L404P probably damaging Het
Cdh13 G A 8: 119,312,525 G569R probably damaging Het
Clec14a G A 12: 58,268,647 T63I probably damaging Het
Cngb1 G T 8: 95,278,259 S487* probably null Het
Cog5 A T 12: 31,833,241 N390Y probably damaging Het
Col6a4 C T 9: 106,022,915 G1670S probably damaging Het
Daxx T A 17: 33,910,605 D53E probably benign Het
Dnah14 C T 1: 181,616,742 T539I possibly damaging Het
Dnajc2 A G 5: 21,760,624 probably null Het
Ehmt1 C T 2: 24,884,634 G53R probably benign Het
Eif2b1 T A 5: 124,576,830 N113Y probably benign Het
Eya3 A G 4: 132,680,848 T152A possibly damaging Het
Fam234b G A 6: 135,217,011 V221M probably benign Het
Fbxl13 T A 5: 21,581,983 T319S probably benign Het
Fchsd2 G T 7: 101,271,624 V479F possibly damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Fxn C T 19: 24,280,496 V24I probably benign Het
Gapvd1 C T 2: 34,725,118 D456N probably benign Het
Gm128 C T 3: 95,240,567 V139M possibly damaging Het
Gm973 A G 1: 59,526,813 T64A probably damaging Het
Gtf2h5 T A 17: 6,084,628 N64K probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Haus6 A G 4: 86,594,773 S386P possibly damaging Het
Hsh2d A G 8: 72,196,794 probably null Het
Htt T C 5: 34,790,353 M125T possibly damaging Het
Inpp5d T A 1: 87,708,211 probably null Het
Ints4 G A 7: 97,490,972 A137T probably benign Het
Isl2 A G 9: 55,544,352 D263G probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Jpt1 A T 11: 115,498,269 L116Q probably damaging Het
Kansl2 A G 15: 98,531,894 S86P possibly damaging Het
Kat2b G T 17: 53,610,925 R104I possibly damaging Het
Kcna10 C A 3: 107,195,046 A331D probably benign Het
Kcnk3 G A 5: 30,622,331 V242M possibly damaging Het
Kdm4a A G 4: 118,160,243 L542P probably damaging Het
Kif20b T C 19: 34,929,687 F119L probably damaging Het
Krtcap3 A T 5: 31,252,537 H149L probably benign Het
Lhx4 A G 1: 155,710,259 V102A probably damaging Het
Luc7l T A 17: 26,253,182 probably benign Het
Myh15 G T 16: 49,155,537 A1323S possibly damaging Het
Myl1 T A 1: 66,926,179 R151S unknown Het
Naif1 A G 2: 32,452,571 S45G probably benign Het
Ndst4 C T 3: 125,708,151 T121I probably damaging Het
Neurod6 C T 6: 55,679,298 R118Q probably damaging Het
Npl A T 1: 153,537,511 probably null Het
Nr4a3 T C 4: 48,051,476 Y77H probably damaging Het
Olfr1254 A T 2: 89,788,976 C125* probably null Het
Olfr1270 T G 2: 90,149,487 D173A probably damaging Het
Pex11a G A 7: 79,742,987 probably benign Het
Rab44 T A 17: 29,140,496 F553I unknown Het
Sbf2 C T 7: 110,365,821 R1002H probably damaging Het
Sectm1a C A 11: 121,069,293 probably null Het
Slit3 G A 11: 35,686,428 V1163M possibly damaging Het
Sphk2 G A 7: 45,711,756 R275C probably damaging Het
Tango6 A G 8: 106,688,834 S96G probably benign Het
Tg A G 15: 66,696,583 E1373G probably damaging Het
Traf3ip1 T A 1: 91,507,736 probably null Het
Trp53 T C 11: 69,588,388 F131L probably damaging Het
Ttc21a A T 9: 119,959,051 E847D probably benign Het
Ttn A G 2: 76,772,447 F18477S probably damaging Het
Usp25 A T 16: 77,113,842 R929* probably null Het
Usp49 G T 17: 47,672,168 E33* probably null Het
Vmn1r63 A G 7: 5,803,555 V26A possibly damaging Het
Vmn1r74 A T 7: 11,847,154 Y127F possibly damaging Het
Wdfy3 C T 5: 101,957,500 V154I probably benign Het
Xdh A G 17: 73,913,965 S590P possibly damaging Het
Zkscan4 A G 13: 21,484,629 K446E probably damaging Het
Other mutations in Fgd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Fgd5 APN 6 91988459 missense possibly damaging 0.63
IGL01354:Fgd5 APN 6 92061843 nonsense probably null
IGL01597:Fgd5 APN 6 91987929 missense probably damaging 1.00
IGL01648:Fgd5 APN 6 91989359 nonsense probably null
IGL01781:Fgd5 APN 6 91988717 missense possibly damaging 0.88
IGL01977:Fgd5 APN 6 92024562 missense probably benign 0.20
IGL02053:Fgd5 APN 6 92053244 missense probably benign 0.03
IGL02206:Fgd5 APN 6 91987258 utr 5 prime probably benign
IGL02825:Fgd5 APN 6 92038087 splice site probably null
IGL02838:Fgd5 APN 6 91987674 missense probably benign
IGL03126:Fgd5 APN 6 92065164 missense probably damaging 1.00
IGL03369:Fgd5 APN 6 91988415 missense probably damaging 1.00
hygeia UTSW 6 91989300 missense probably damaging 1.00
R0029:Fgd5 UTSW 6 92067558 missense probably benign 0.04
R0109:Fgd5 UTSW 6 91988235 missense possibly damaging 0.74
R0109:Fgd5 UTSW 6 91988235 missense possibly damaging 0.74
R0212:Fgd5 UTSW 6 91988208 missense probably damaging 1.00
R1148:Fgd5 UTSW 6 91987631 missense probably benign
R1148:Fgd5 UTSW 6 91987631 missense probably benign
R1159:Fgd5 UTSW 6 91988502 missense probably benign 0.00
R1199:Fgd5 UTSW 6 91986978 missense possibly damaging 0.87
R1493:Fgd5 UTSW 6 91987631 missense probably benign
R1602:Fgd5 UTSW 6 92066184 missense possibly damaging 0.95
R1953:Fgd5 UTSW 6 92024630 missense probably benign 0.31
R2280:Fgd5 UTSW 6 91988945 missense possibly damaging 0.86
R2437:Fgd5 UTSW 6 92062869 nonsense probably null
R2883:Fgd5 UTSW 6 91987109 unclassified probably null
R4133:Fgd5 UTSW 6 92069437 missense probably damaging 1.00
R4454:Fgd5 UTSW 6 91989186 missense probably damaging 1.00
R4491:Fgd5 UTSW 6 91989299 missense possibly damaging 0.90
R4606:Fgd5 UTSW 6 91988209 missense possibly damaging 0.67
R4981:Fgd5 UTSW 6 91989300 missense probably damaging 1.00
R5162:Fgd5 UTSW 6 92074234 missense probably damaging 1.00
R5525:Fgd5 UTSW 6 92066247 missense probably damaging 1.00
R5570:Fgd5 UTSW 6 91988687 missense probably damaging 1.00
R5936:Fgd5 UTSW 6 91987911 missense probably damaging 0.98
R6012:Fgd5 UTSW 6 91989341 missense possibly damaging 0.95
R6723:Fgd5 UTSW 6 91988030 missense probably benign
R6764:Fgd5 UTSW 6 91989421 missense probably damaging 0.96
R7187:Fgd5 UTSW 6 91988291 missense possibly damaging 0.54
R7383:Fgd5 UTSW 6 91987118 missense probably benign 0.01
R7662:Fgd5 UTSW 6 92049931 intron probably null
R7788:Fgd5 UTSW 6 91988459 missense possibly damaging 0.63
R7882:Fgd5 UTSW 6 92068478 missense probably damaging 1.00
R7895:Fgd5 UTSW 6 91987281 missense probably benign 0.03
R7965:Fgd5 UTSW 6 92068478 missense probably damaging 1.00
R7978:Fgd5 UTSW 6 91987281 missense probably benign 0.03
R8041:Fgd5 UTSW 6 92061856 missense probably damaging 0.98
R8053:Fgd5 UTSW 6 91989444 missense probably benign 0.34
X0064:Fgd5 UTSW 6 92050040 missense probably benign 0.02
Z1176:Fgd5 UTSW 6 91988889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGGTTGTCTTAAGCAGC -3'
(R):5'- CAGGGTGTGGTCTTTCCCATTC -3'

Sequencing Primer
(F):5'- CTTAAGCAGCATGTGTAAAGGTACC -3'
(R):5'- GGTGTGGTCTTTCCCATTCTCTCC -3'
Posted On2019-10-07