Incidental Mutation 'R7418:Pex11a'
ID575455
Institutional Source Beutler Lab
Gene Symbol Pex11a
Ensembl Gene ENSMUSG00000030545
Gene Nameperoxisomal biogenesis factor 11 alpha
SynonymsPEX11alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R7418 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79735957-79743131 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 79742987 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032761] [ENSMUST00000035622]
Predicted Effect probably benign
Transcript: ENSMUST00000032761
SMART Domains Protein: ENSMUSP00000032761
Gene: ENSMUSG00000030545

DomainStartEndE-ValueType
Pfam:PEX11 1 237 4.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035622
SMART Domains Protein: ENSMUSP00000037467
Gene: ENSMUSG00000039099

DomainStartEndE-ValueType
low complexity region 240 251 N/A INTRINSIC
low complexity region 265 274 N/A INTRINSIC
SCOP:d1jofa_ 389 607 7e-4 SMART
Blast:WD40 413 451 2e-11 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the PEX11 family, which is composed of membrane elongation factors involved in regulation of peroxisome maintenance and proliferation. This gene product interacts with peroxisomal membrane protein 19 and may respond to outside stimuli to increase peroxisome abundance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit minor abnormalities of the mitochondria and peroxisomes. Mice homozygous for a different knock-out allele exhibit increased body weight, hepatic steatosis and fewer, smaller peroxisomes in hepatocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 T G 10: 91,023,835 H827P probably benign Het
Atp8b3 A T 10: 80,530,092 L308Q probably damaging Het
Ccdc180 T C 4: 45,904,616 L404P probably damaging Het
Cdh13 G A 8: 119,312,525 G569R probably damaging Het
Clec14a G A 12: 58,268,647 T63I probably damaging Het
Cngb1 G T 8: 95,278,259 S487* probably null Het
Cog5 A T 12: 31,833,241 N390Y probably damaging Het
Col6a4 C T 9: 106,022,915 G1670S probably damaging Het
Daxx T A 17: 33,910,605 D53E probably benign Het
Dnah14 C T 1: 181,616,742 T539I possibly damaging Het
Dnajc2 A G 5: 21,760,624 probably null Het
Ehmt1 C T 2: 24,884,634 G53R probably benign Het
Eif2b1 T A 5: 124,576,830 N113Y probably benign Het
Eya3 A G 4: 132,680,848 T152A possibly damaging Het
Fam234b G A 6: 135,217,011 V221M probably benign Het
Fbxl13 T A 5: 21,581,983 T319S probably benign Het
Fchsd2 G T 7: 101,271,624 V479F possibly damaging Het
Fgd5 T C 6: 92,024,538 S905P probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Fxn C T 19: 24,280,496 V24I probably benign Het
Gapvd1 C T 2: 34,725,118 D456N probably benign Het
Gm128 C T 3: 95,240,567 V139M possibly damaging Het
Gm973 A G 1: 59,526,813 T64A probably damaging Het
Gtf2h5 T A 17: 6,084,628 N64K probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Haus6 A G 4: 86,594,773 S386P possibly damaging Het
Hsh2d A G 8: 72,196,794 probably null Het
Htt T C 5: 34,790,353 M125T possibly damaging Het
Inpp5d T A 1: 87,708,211 probably null Het
Ints4 G A 7: 97,490,972 A137T probably benign Het
Isl2 A G 9: 55,544,352 D263G probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Jpt1 A T 11: 115,498,269 L116Q probably damaging Het
Kansl2 A G 15: 98,531,894 S86P possibly damaging Het
Kat2b G T 17: 53,610,925 R104I possibly damaging Het
Kcna10 C A 3: 107,195,046 A331D probably benign Het
Kcnk3 G A 5: 30,622,331 V242M possibly damaging Het
Kdm4a A G 4: 118,160,243 L542P probably damaging Het
Kif20b T C 19: 34,929,687 F119L probably damaging Het
Krtcap3 A T 5: 31,252,537 H149L probably benign Het
Lhx4 A G 1: 155,710,259 V102A probably damaging Het
Luc7l T A 17: 26,253,182 probably benign Het
Myh15 G T 16: 49,155,537 A1323S possibly damaging Het
Myl1 T A 1: 66,926,179 R151S unknown Het
Naif1 A G 2: 32,452,571 S45G probably benign Het
Ndst4 C T 3: 125,708,151 T121I probably damaging Het
Neurod6 C T 6: 55,679,298 R118Q probably damaging Het
Npl A T 1: 153,537,511 probably null Het
Nr4a3 T C 4: 48,051,476 Y77H probably damaging Het
Olfr1254 A T 2: 89,788,976 C125* probably null Het
Olfr1270 T G 2: 90,149,487 D173A probably damaging Het
Rab44 T A 17: 29,140,496 F553I unknown Het
Sbf2 C T 7: 110,365,821 R1002H probably damaging Het
Sectm1a C A 11: 121,069,293 probably null Het
Slit3 G A 11: 35,686,428 V1163M possibly damaging Het
Sphk2 G A 7: 45,711,756 R275C probably damaging Het
Tango6 A G 8: 106,688,834 S96G probably benign Het
Tg A G 15: 66,696,583 E1373G probably damaging Het
Traf3ip1 T A 1: 91,507,736 probably null Het
Trp53 T C 11: 69,588,388 F131L probably damaging Het
Ttc21a A T 9: 119,959,051 E847D probably benign Het
Ttn A G 2: 76,772,447 F18477S probably damaging Het
Usp25 A T 16: 77,113,842 R929* probably null Het
Usp49 G T 17: 47,672,168 E33* probably null Het
Vmn1r63 A G 7: 5,803,555 V26A possibly damaging Het
Vmn1r74 A T 7: 11,847,154 Y127F possibly damaging Het
Wdfy3 C T 5: 101,957,500 V154I probably benign Het
Xdh A G 17: 73,913,965 S590P possibly damaging Het
Zkscan4 A G 13: 21,484,629 K446E probably damaging Het
Other mutations in Pex11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02448:Pex11a APN 7 79737460 unclassified probably null
IGL03085:Pex11a APN 7 79737775 missense probably damaging 1.00
R3739:Pex11a UTSW 7 79740170 missense possibly damaging 0.79
R6164:Pex11a UTSW 7 79737379 missense probably damaging 1.00
R6718:Pex11a UTSW 7 79737482 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGGAGATCGCACTCATGGG -3'
(R):5'- CCTTAGTAACTACCACTTCCGG -3'

Sequencing Primer
(F):5'- TGGCTGACACGCACAGTC -3'
(R):5'- TAGTAACTACCACTTCCGGTACTAAC -3'
Posted On2019-10-07