Mutagenetix > Incidental Mutations

Incidental Mutation 'R7418:Sbf2'

575458

Institutional Source

Beutler Lab

Gene Symbol

Sbf2

Ensembl Gene

ENSMUSG00000038371

Gene Name

SET binding factor 2

Synonyms

mMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2

MMRRC Submission

Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene?

Possibly non essential (E-score: 0.411) question?

Stock #

R7418 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110308013-110614922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 110365821 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 1002 (R1002H)

Ref Sequence

ENSEMBL: ENSMUSP00000033058 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033058
AA Change: R1002H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: R1002H

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	530	752	3.3e-106	PFAM
GRAM	869	955	1.3e-12	SMART
low complexity region	1078	1089	N/A	INTRINSIC
Pfam:Myotub-related	1091	1544	8.3e-86	PFAM
PH	1767	1872	3.05e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164525

SMART Domains

Protein: ENSMUSP00000128340
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
Pfam:Myotub-related	28	217	1.5e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164599

SMART Domains

Protein: ENSMUSP00000131927
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	1	339	1.9e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000164759
AA Change: R1002H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: R1002H

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	528	752	1.6e-107	PFAM
GRAM	869	955	1.3e-12	SMART
Pfam:Myotub-related	1089	1521	1.6e-98	PFAM
PH	1742	1847	3.05e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166020
AA Change: R956H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: R956H

Domain	Start	End	E-Value	Type
uDENN	1	75	9.26e-1	SMART
DENN	70	252	5.68e-75	SMART
dDENN	305	374	2e-20	SMART
Pfam:SBF2	482	706	1.6e-107	PFAM
GRAM	823	909	1.3e-12	SMART
Pfam:Myotub-related	1043	1500	5.9e-98	PFAM
PH	1721	1826	3.05e-18	SMART

Meta Mutation Damage Score

0.3247

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (66/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apaf1	T	G	10: 91,023,835	H827P	probably benign	Het
Atp8b3	A	T	10: 80,530,092	L308Q	probably damaging	Het
Ccdc180	T	C	4: 45,904,616	L404P	probably damaging	Het
Cdh13	G	A	8: 119,312,525	G569R	probably damaging	Het
Clec14a	G	A	12: 58,268,647	T63I	probably damaging	Het
Cngb1	G	T	8: 95,278,259	S487*	probably null	Het
Cog5	A	T	12: 31,833,241	N390Y	probably damaging	Het
Col6a4	C	T	9: 106,022,915	G1670S	probably damaging	Het
Daxx	T	A	17: 33,910,605	D53E	probably benign	Het
Dnah14	C	T	1: 181,616,742	T539I	possibly damaging	Het
Dnajc2	A	G	5: 21,760,624		probably null	Het
Ehmt1	C	T	2: 24,884,634	G53R	probably benign	Het
Eif2b1	T	A	5: 124,576,830	N113Y	probably benign	Het
Eya3	A	G	4: 132,680,848	T152A	possibly damaging	Het
Fam234b	G	A	6: 135,217,011	V221M	probably benign	Het
Fbxl13	T	A	5: 21,581,983	T319S	probably benign	Het
Fchsd2	G	T	7: 101,271,624	V479F	possibly damaging	Het
Fgd5	T	C	6: 92,024,538	S905P	probably benign	Het
Fthl17b	C	T	X: 8,962,804	R9Q	possibly damaging	Het
Fthl17b	C	T	X: 8,962,808	V8M	possibly damaging	Het
Fxn	C	T	19: 24,280,496	V24I	probably benign	Het
Gapvd1	C	T	2: 34,725,118	D456N	probably benign	Het
Gm128	C	T	3: 95,240,567	V139M	possibly damaging	Het
Gm973	A	G	1: 59,526,813	T64A	probably damaging	Het
Gtf2h5	T	A	17: 6,084,628	N64K	probably damaging	Het
H2bfm	G	A	X: 136,927,722	R120K	unknown	Het
Haus6	A	G	4: 86,594,773	S386P	possibly damaging	Het
Hsh2d	A	G	8: 72,196,794		probably null	Het
Htt	T	C	5: 34,790,353	M125T	possibly damaging	Het
Inpp5d	T	A	1: 87,708,211		probably null	Het
Ints4	G	A	7: 97,490,972	A137T	probably benign	Het
Isl2	A	G	9: 55,544,352	D263G	probably benign	Het
Itgb5	T	G	16: 33,885,094	D251E	probably damaging	Het
Jpt1	A	T	11: 115,498,269	L116Q	probably damaging	Het
Kansl2	A	G	15: 98,531,894	S86P	possibly damaging	Het
Kat2b	G	T	17: 53,610,925	R104I	possibly damaging	Het
Kcna10	C	A	3: 107,195,046	A331D	probably benign	Het
Kcnk3	G	A	5: 30,622,331	V242M	possibly damaging	Het
Kdm4a	A	G	4: 118,160,243	L542P	probably damaging	Het
Kif20b	T	C	19: 34,929,687	F119L	probably damaging	Het
Krtcap3	A	T	5: 31,252,537	H149L	probably benign	Het
Lhx4	A	G	1: 155,710,259	V102A	probably damaging	Het
Luc7l	T	A	17: 26,253,182		probably benign	Het
Myh15	G	T	16: 49,155,537	A1323S	possibly damaging	Het
Myl1	T	A	1: 66,926,179	R151S	unknown	Het
Naif1	A	G	2: 32,452,571	S45G	probably benign	Het
Ndst4	C	T	3: 125,708,151	T121I	probably damaging	Het
Neurod6	C	T	6: 55,679,298	R118Q	probably damaging	Het
Npl	A	T	1: 153,537,511		probably null	Het
Nr4a3	T	C	4: 48,051,476	Y77H	probably damaging	Het
Olfr1254	A	T	2: 89,788,976	C125*	probably null	Het
Olfr1270	T	G	2: 90,149,487	D173A	probably damaging	Het
Pex11a	G	A	7: 79,742,987		probably benign	Het
Rab44	T	A	17: 29,140,496	F553I	unknown	Het
Sectm1a	C	A	11: 121,069,293		probably null	Het
Slit3	G	A	11: 35,686,428	V1163M	possibly damaging	Het
Sphk2	G	A	7: 45,711,756	R275C	probably damaging	Het
Tango6	A	G	8: 106,688,834	S96G	probably benign	Het
Tg	A	G	15: 66,696,583	E1373G	probably damaging	Het
Traf3ip1	T	A	1: 91,507,736		probably null	Het
Trp53	T	C	11: 69,588,388	F131L	probably damaging	Het
Ttc21a	A	T	9: 119,959,051	E847D	probably benign	Het
Ttn	A	G	2: 76,772,447	F18477S	probably damaging	Het
Usp25	A	T	16: 77,113,842	R929*	probably null	Het
Usp49	G	T	17: 47,672,168	E33*	probably null	Het
Vmn1r63	A	G	7: 5,803,555	V26A	possibly damaging	Het
Vmn1r74	A	T	7: 11,847,154	Y127F	possibly damaging	Het
Wdfy3	C	T	5: 101,957,500	V154I	probably benign	Het
Xdh	A	G	17: 73,913,965	S590P	possibly damaging	Het
Zkscan4	A	G	13: 21,484,629	K446E	probably damaging	Het

Other mutations in Sbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sbf2	APN	7	110375832	splice site	probably benign
IGL01089:Sbf2	APN	7	110348962	missense	probably damaging	1.00
IGL01144:Sbf2	APN	7	110329903	missense	probably damaging	1.00
IGL01652:Sbf2	APN	7	110447120	missense	probably damaging	1.00
IGL01950:Sbf2	APN	7	110365825	missense	probably benign	0.00
IGL02027:Sbf2	APN	7	110461141	missense	probably damaging	1.00
IGL02244:Sbf2	APN	7	110560295	missense	probably damaging	1.00
IGL02376:Sbf2	APN	7	110462956	missense	probably damaging	0.99
IGL03405:Sbf2	APN	7	110462932	missense	probably damaging	0.98
N/A - 535:Sbf2	UTSW	7	110312752	missense	probably benign
R0084:Sbf2	UTSW	7	110442366	missense	possibly damaging	0.95
R0092:Sbf2	UTSW	7	110320806	splice site	probably benign
R0121:Sbf2	UTSW	7	110489219	critical splice donor site	probably null
R0464:Sbf2	UTSW	7	110464576	splice site	probably benign
R0505:Sbf2	UTSW	7	110399343	missense	probably damaging	1.00
R0531:Sbf2	UTSW	7	110367323	splice site	probably benign
R0554:Sbf2	UTSW	7	110428287	missense	probably damaging	1.00
R0617:Sbf2	UTSW	7	110330683	frame shift	probably null
R0619:Sbf2	UTSW	7	110310262	missense	possibly damaging	0.87
R0799:Sbf2	UTSW	7	110341355	missense	possibly damaging	0.58
R0898:Sbf2	UTSW	7	110371652	missense	possibly damaging	0.59
R1077:Sbf2	UTSW	7	110367172	splice site	probably benign
R1167:Sbf2	UTSW	7	110364549	missense	probably damaging	1.00
R1169:Sbf2	UTSW	7	110310184	missense	probably benign	0.04
R1424:Sbf2	UTSW	7	110315026	missense	probably damaging	1.00
R1536:Sbf2	UTSW	7	110378043	missense	probably damaging	1.00
R1558:Sbf2	UTSW	7	110428346	missense	probably damaging	1.00
R1601:Sbf2	UTSW	7	110340076	critical splice acceptor site	probably null
R1762:Sbf2	UTSW	7	110312758	missense	probably benign
R1771:Sbf2	UTSW	7	110461146	nonsense	probably null
R1989:Sbf2	UTSW	7	110348923	missense	possibly damaging	0.94
R2109:Sbf2	UTSW	7	110461212	missense	probably damaging	1.00
R2126:Sbf2	UTSW	7	110560295	missense	probably damaging	1.00
R2444:Sbf2	UTSW	7	110330698	missense	probably benign	0.31
R3765:Sbf2	UTSW	7	110375581	missense	probably damaging	1.00
R3808:Sbf2	UTSW	7	110489280	makesense	probably null
R3895:Sbf2	UTSW	7	110447091	missense	probably damaging	0.99
R3978:Sbf2	UTSW	7	110329885	missense	probably benign	0.00
R4056:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4057:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4111:Sbf2	UTSW	7	110428242	missense	probably damaging	1.00
R4569:Sbf2	UTSW	7	110348853	critical splice donor site	probably null
R4670:Sbf2	UTSW	7	110335399	missense	probably damaging	1.00
R4763:Sbf2	UTSW	7	110420917	missense	probably damaging	1.00
R4792:Sbf2	UTSW	7	110351610	missense	probably damaging	0.98
R4811:Sbf2	UTSW	7	110372535	missense	probably damaging	1.00
R4822:Sbf2	UTSW	7	110377939	intron	probably benign
R5110:Sbf2	UTSW	7	110364657	missense	probably benign	0.10
R5143:Sbf2	UTSW	7	110422540	nonsense	probably null
R5443:Sbf2	UTSW	7	110377928	intron	probably benign
R5457:Sbf2	UTSW	7	110312830	missense	probably benign
R5641:Sbf2	UTSW	7	110438901	missense	probably damaging	1.00
R5915:Sbf2	UTSW	7	110378096	nonsense	probably null
R5948:Sbf2	UTSW	7	110489285	missense	probably damaging	1.00
R5977:Sbf2	UTSW	7	110377986	missense	probably benign	0.00
R6052:Sbf2	UTSW	7	110441534	missense	probably damaging	1.00
R6142:Sbf2	UTSW	7	110348975	missense	probably damaging	1.00
R6327:Sbf2	UTSW	7	110441552	missense	probably damaging	1.00
R6356:Sbf2	UTSW	7	110372623	missense	probably damaging	1.00
R6450:Sbf2	UTSW	7	110462863	missense	probably damaging	1.00
R6587:Sbf2	UTSW	7	110440975	missense	probably damaging	1.00
R6696:Sbf2	UTSW	7	110560298	missense	probably benign	0.04
R6986:Sbf2	UTSW	7	110330615	missense	probably damaging	0.99
R7147:Sbf2	UTSW	7	110447061	missense	probably benign	0.01
R7358:Sbf2	UTSW	7	110399348	missense	possibly damaging	0.95
R7414:Sbf2	UTSW	7	110314064	missense	possibly damaging	0.89
R7423:Sbf2	UTSW	7	110438848	missense	possibly damaging	0.48
R7425:Sbf2	UTSW	7	110375777	nonsense	probably null
R7431:Sbf2	UTSW	7	110351750	missense	probably damaging	1.00
R7497:Sbf2	UTSW	7	110614716	nonsense	probably null
R7556:Sbf2	UTSW	7	110314053	missense	probably benign	0.20
R7604:Sbf2	UTSW	7	110378067	missense	possibly damaging	0.95
R7707:Sbf2	UTSW	7	110330713	critical splice acceptor site	probably null
R7746:Sbf2	UTSW	7	110441426	missense	probably benign	0.01
R7812:Sbf2	UTSW	7	110449963	missense	possibly damaging	0.84
R7849:Sbf2	UTSW	7	110372510	missense	probably damaging	1.00
R8026:Sbf2	UTSW	7	110335387	missense	probably damaging	1.00
R8048:Sbf2	UTSW	7	110315082	missense	probably benign	0.21
R8305:Sbf2	UTSW	7	110371618	missense	possibly damaging	0.79
R8337:Sbf2	UTSW	7	110441462	missense	probably benign
RF005:Sbf2	UTSW	7	110317008	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTATAAACCTGTTCAAGCATAGAAAA -3'
(R):5'- AGTCTCTACAACTTCCAAAATCCTAT -3'

Sequencing Primer
(F):5'- ATGATCTGAGTTTAACCCCTGGGAC -3'
(R):5'- TCTGTTCACTTTCATTTTCTTGTTTG -3'

Posted On

2019-10-07