Mutagenetix > Incidental Mutation

Incidental Mutation 'R7418:Col6a4'

575464

Institutional Source

Beutler Lab

Gene Symbol

Col6a4

Ensembl Gene

ENSMUSG00000032572

Gene Name

collagen, type VI, alpha 4

Synonyms

Vwa6, 1110001D15Rik, EG235580, Dvwa

MMRRC Submission

045496-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7418 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105989454-106096783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 106022915 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 1670 (G1670S)

Ref Sequence

ENSEMBL: ENSMUSP00000112472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121963]

AlphaFold

A2AX52

Predicted Effect

probably damaging
Transcript: ENSMUST00000121963
AA Change: G1670S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: G1670S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWA	32	211	2.44e-35	SMART
VWA	233	410	8.67e-50	SMART
VWA	428	604	2.74e-29	SMART
VWA	632	816	4.78e-20	SMART
VWA	847	1019	3.02e-40	SMART
VWA	1028	1204	3.17e-43	SMART
VWA	1210	1391	4.73e-1	SMART
low complexity region	1444	1462	N/A	INTRINSIC
PDB:3HR2\|B	1469	1593	3e-7	PDB
low complexity region	1594	1622	N/A	INTRINSIC
low complexity region	1625	1643	N/A	INTRINSIC
low complexity region	1649	1671	N/A	INTRINSIC
Pfam:Collagen	1684	1748	1.4e-9	PFAM
VWA	1774	1953	2.18e-14	SMART
VWA	1980	2174	1.89e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (66/69)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apaf1	T	G	10: 91,023,835	H827P	probably benign	Het
Atp8b3	A	T	10: 80,530,092	L308Q	probably damaging	Het
Ccdc180	T	C	4: 45,904,616	L404P	probably damaging	Het
Cdh13	G	A	8: 119,312,525	G569R	probably damaging	Het
Clec14a	G	A	12: 58,268,647	T63I	probably damaging	Het
Cngb1	G	T	8: 95,278,259	S487*	probably null	Het
Cog5	A	T	12: 31,833,241	N390Y	probably damaging	Het
Daxx	T	A	17: 33,910,605	D53E	probably benign	Het
Dnah14	C	T	1: 181,616,742	T539I	possibly damaging	Het
Dnajc2	A	G	5: 21,760,624		probably null	Het
Ehmt1	C	T	2: 24,884,634	G53R	probably benign	Het
Eif2b1	T	A	5: 124,576,830	N113Y	probably benign	Het
Eya3	A	G	4: 132,680,848	T152A	possibly damaging	Het
Fam234b	G	A	6: 135,217,011	V221M	probably benign	Het
Fbxl13	T	A	5: 21,581,983	T319S	probably benign	Het
Fchsd2	G	T	7: 101,271,624	V479F	possibly damaging	Het
Fgd5	T	C	6: 92,024,538	S905P	probably benign	Het
Fthl17b	C	T	X: 8,962,804	R9Q	possibly damaging	Het
Fthl17b	C	T	X: 8,962,808	V8M	possibly damaging	Het
Fxn	C	T	19: 24,280,496	V24I	probably benign	Het
Gapvd1	C	T	2: 34,725,118	D456N	probably benign	Het
Gm128	C	T	3: 95,240,567	V139M	possibly damaging	Het
Gm973	A	G	1: 59,526,813	T64A	probably damaging	Het
Gtf2h5	T	A	17: 6,084,628	N64K	probably damaging	Het
H2bfm	G	A	X: 136,927,722	R120K	unknown	Het
Haus6	A	G	4: 86,594,773	S386P	possibly damaging	Het
Hsh2d	A	G	8: 72,196,794		probably null	Het
Htt	T	C	5: 34,790,353	M125T	possibly damaging	Het
Inpp5d	T	A	1: 87,708,211		probably null	Het
Ints4	G	A	7: 97,490,972	A137T	probably benign	Het
Isl2	A	G	9: 55,544,352	D263G	probably benign	Het
Itgb5	T	G	16: 33,885,094	D251E	probably damaging	Het
Jpt1	A	T	11: 115,498,269	L116Q	probably damaging	Het
Kansl2	A	G	15: 98,531,894	S86P	possibly damaging	Het
Kat2b	G	T	17: 53,610,925	R104I	possibly damaging	Het
Kcna10	C	A	3: 107,195,046	A331D	probably benign	Het
Kcnk3	G	A	5: 30,622,331	V242M	possibly damaging	Het
Kdm4a	A	G	4: 118,160,243	L542P	probably damaging	Het
Kif20b	T	C	19: 34,929,687	F119L	probably damaging	Het
Krtcap3	A	T	5: 31,252,537	H149L	probably benign	Het
Lhx4	A	G	1: 155,710,259	V102A	probably damaging	Het
Luc7l	T	A	17: 26,253,182		probably benign	Het
Myh15	G	T	16: 49,155,537	A1323S	possibly damaging	Het
Myl1	T	A	1: 66,926,179	R151S	unknown	Het
Naif1	A	G	2: 32,452,571	S45G	probably benign	Het
Ndst4	C	T	3: 125,708,151	T121I	probably damaging	Het
Neurod6	C	T	6: 55,679,298	R118Q	probably damaging	Het
Npl	A	T	1: 153,537,511		probably null	Het
Nr4a3	T	C	4: 48,051,476	Y77H	probably damaging	Het
Olfr1254	A	T	2: 89,788,976	C125*	probably null	Het
Olfr1270	T	G	2: 90,149,487	D173A	probably damaging	Het
Pex11a	G	A	7: 79,742,987		probably benign	Het
Rab44	T	A	17: 29,140,496	F553I	unknown	Het
Sbf2	C	T	7: 110,365,821	R1002H	probably damaging	Het
Sectm1a	C	A	11: 121,069,293		probably null	Het
Slit3	G	A	11: 35,686,428	V1163M	possibly damaging	Het
Sphk2	G	A	7: 45,711,756	R275C	probably damaging	Het
Tango6	A	G	8: 106,688,834	S96G	probably benign	Het
Tg	A	G	15: 66,696,583	E1373G	probably damaging	Het
Traf3ip1	T	A	1: 91,507,736		probably null	Het
Trp53	T	C	11: 69,588,388	F131L	probably damaging	Het
Ttc21a	A	T	9: 119,959,051	E847D	probably benign	Het
Ttn	A	G	2: 76,772,447	F18477S	probably damaging	Het
Usp25	A	T	16: 77,113,842	R929*	probably null	Het
Usp49	G	T	17: 47,672,168	E33*	probably null	Het
Vmn1r63	A	G	7: 5,803,555	V26A	possibly damaging	Het
Vmn1r74	A	T	7: 11,847,154	Y127F	possibly damaging	Het
Wdfy3	C	T	5: 101,957,500	V154I	probably benign	Het
Xdh	A	G	17: 73,913,965	S590P	possibly damaging	Het
Zkscan4	A	G	13: 21,484,629	K446E	probably damaging	Het

Other mutations in Col6a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Col6a4	APN	9	106022896	missense	probably benign	0.00
IGL00691:Col6a4	APN	9	106057407	missense	probably damaging	1.00
IGL01508:Col6a4	APN	9	106013605	missense	possibly damaging	0.95
IGL01580:Col6a4	APN	9	106068198	missense	probably damaging	1.00
IGL01610:Col6a4	APN	9	106047707	splice site	probably benign
IGL01813:Col6a4	APN	9	106077253	missense	probably damaging	1.00
IGL01933:Col6a4	APN	9	106060114	missense	probably benign	0.04
IGL01973:Col6a4	APN	9	106062894	missense	probably damaging	1.00
IGL02053:Col6a4	APN	9	106063095	missense	possibly damaging	0.92
IGL02063:Col6a4	APN	9	106057418	missense	probably benign	0.01
IGL02065:Col6a4	APN	9	106077103	missense	probably damaging	0.99
IGL02106:Col6a4	APN	9	106063105	missense	possibly damaging	0.95
IGL02220:Col6a4	APN	9	106062942	missense	possibly damaging	0.91
IGL02228:Col6a4	APN	9	106068078	missense	probably benign
IGL02234:Col6a4	APN	9	106013432	missense	possibly damaging	0.92
IGL02294:Col6a4	APN	9	106066732	missense	probably benign	0.04
IGL02314:Col6a4	APN	9	105997156	missense	probably damaging	0.99
IGL03065:Col6a4	APN	9	106041164	splice site	probably benign
IGL03086:Col6a4	APN	9	106082862	splice site	probably benign
IGL03185:Col6a4	APN	9	106019454	missense	probably damaging	0.97
R0092:Col6a4	UTSW	9	106013314	missense	probably benign	0.04
R0095:Col6a4	UTSW	9	106075356	missense	probably benign	0.03
R0230:Col6a4	UTSW	9	106072366	missense	probably benign	0.11
R0359:Col6a4	UTSW	9	105997146	missense	probably benign
R0415:Col6a4	UTSW	9	106075080	missense	probably damaging	0.99
R0433:Col6a4	UTSW	9	106067994	missense	probably damaging	0.99
R0450:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0469:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0490:Col6a4	UTSW	9	106013770	missense	probably damaging	0.99
R0621:Col6a4	UTSW	9	106066791	missense	probably damaging	0.97
R0667:Col6a4	UTSW	9	106029959	splice site	probably benign
R0681:Col6a4	UTSW	9	106067144	nonsense	probably null
R0690:Col6a4	UTSW	9	106028187	splice site	probably benign
R0714:Col6a4	UTSW	9	106017903	unclassified	probably benign
R0788:Col6a4	UTSW	9	106071998	missense	probably benign	0.15
R1036:Col6a4	UTSW	9	106068198	missense	probably damaging	1.00
R1296:Col6a4	UTSW	9	106062853	missense	possibly damaging	0.47
R1386:Col6a4	UTSW	9	106062945	missense	probably benign	0.15
R1484:Col6a4	UTSW	9	106013302	critical splice donor site	probably null
R1528:Col6a4	UTSW	9	106075220	missense	probably damaging	0.99
R1555:Col6a4	UTSW	9	106000886	missense	possibly damaging	0.93
R1622:Col6a4	UTSW	9	105997135	missense	probably benign	0.01
R1653:Col6a4	UTSW	9	106072409	missense	probably damaging	0.99
R1720:Col6a4	UTSW	9	106026472	missense	probably damaging	1.00
R1768:Col6a4	UTSW	9	106080100	missense	probably benign
R1941:Col6a4	UTSW	9	106075010	missense	probably benign	0.00
R2092:Col6a4	UTSW	9	106060331	missense	probably damaging	1.00
R2134:Col6a4	UTSW	9	106066661	missense	probably benign	0.09
R2149:Col6a4	UTSW	9	106076929	missense	probably benign	0.00
R2174:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2204:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2248:Col6a4	UTSW	9	106079959	missense	probably benign	0.15
R2568:Col6a4	UTSW	9	106063076	missense	possibly damaging	0.90
R3750:Col6a4	UTSW	9	106020665	critical splice acceptor site	probably null
R3751:Col6a4	UTSW	9	106072114	missense	probably damaging	0.98
R3776:Col6a4	UTSW	9	106051701	nonsense	probably null
R3872:Col6a4	UTSW	9	106013659	missense	possibly damaging	0.95
R4043:Col6a4	UTSW	9	106072411	nonsense	probably null
R4056:Col6a4	UTSW	9	106026466	missense	probably damaging	0.98
R4212:Col6a4	UTSW	9	106075370	missense	probably benign	0.28
R4417:Col6a4	UTSW	9	106072016	missense	probably damaging	0.99
R4683:Col6a4	UTSW	9	106080130	missense	probably benign	0.00
R4719:Col6a4	UTSW	9	106068252	missense	probably damaging	0.99
R4791:Col6a4	UTSW	9	106080202	missense	possibly damaging	0.68
R4833:Col6a4	UTSW	9	106071979	missense	probably benign	0.00
R4886:Col6a4	UTSW	9	106060072	missense	probably benign	0.00
R4998:Col6a4	UTSW	9	105990778	utr 3 prime	probably benign
R5091:Col6a4	UTSW	9	106075063	missense	probably damaging	1.00
R5113:Col6a4	UTSW	9	106066960	missense	possibly damaging	0.89
R5129:Col6a4	UTSW	9	106013377	missense	probably damaging	0.98
R5231:Col6a4	UTSW	9	106025531	missense	probably damaging	0.96
R5297:Col6a4	UTSW	9	106074867	missense	probably benign	0.02
R5352:Col6a4	UTSW	9	106061544	missense	probably damaging	1.00
R5438:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5518:Col6a4	UTSW	9	106072188	missense	possibly damaging	0.68
R5657:Col6a4	UTSW	9	106072198	missense	probably damaging	0.99
R5660:Col6a4	UTSW	9	105996116	missense	probably benign	0.01
R5662:Col6a4	UTSW	9	106068001	missense	probably damaging	0.99
R5777:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5800:Col6a4	UTSW	9	106080275	missense	probably damaging	0.99
R5929:Col6a4	UTSW	9	106063044	missense	probably benign	0.15
R5999:Col6a4	UTSW	9	106067921	missense	probably benign	0.11
R6243:Col6a4	UTSW	9	106013390	missense	possibly damaging	0.95
R6285:Col6a4	UTSW	9	106074986	missense	probably damaging	0.96
R6288:Col6a4	UTSW	9	106068263	missense	probably damaging	0.99
R6361:Col6a4	UTSW	9	106066703	missense	probably benign	0.28
R6485:Col6a4	UTSW	9	106076870	critical splice donor site	probably null
R6490:Col6a4	UTSW	9	106074992	nonsense	probably null
R6537:Col6a4	UTSW	9	106067954	missense	possibly damaging	0.87
R6598:Col6a4	UTSW	9	106000412	missense	probably damaging	0.99
R6643:Col6a4	UTSW	9	106000631	missense	probably damaging	0.96
R6905:Col6a4	UTSW	9	106060318	splice site	probably null
R6944:Col6a4	UTSW	9	106072171	missense	probably damaging	0.98
R7015:Col6a4	UTSW	9	106033755	critical splice donor site	probably null
R7027:Col6a4	UTSW	9	106067014	missense	probably damaging	1.00
R7088:Col6a4	UTSW	9	106000686	missense	possibly damaging	0.56
R7200:Col6a4	UTSW	9	106072249	missense	possibly damaging	0.68
R7238:Col6a4	UTSW	9	106000320	missense	probably damaging	0.99
R7273:Col6a4	UTSW	9	106000457	missense	possibly damaging	0.92
R7335:Col6a4	UTSW	9	106076892	missense	possibly damaging	0.90
R7421:Col6a4	UTSW	9	106020795	missense	probably damaging	0.99
R7530:Col6a4	UTSW	9	106068390	missense	probably damaging	0.99
R7600:Col6a4	UTSW	9	106066999	missense	possibly damaging	0.86
R7701:Col6a4	UTSW	9	106082888	missense	probably benign	0.17
R7830:Col6a4	UTSW	9	106075390	missense	probably damaging	0.99
R7881:Col6a4	UTSW	9	106080298	missense	probably benign	0.14
R8157:Col6a4	UTSW	9	106067898	missense	possibly damaging	0.92
R8292:Col6a4	UTSW	9	106076877	missense	probably benign	0.01
R8309:Col6a4	UTSW	9	106075215	missense	probably benign	0.08
R8336:Col6a4	UTSW	9	106075329	missense	possibly damaging	0.65
R8359:Col6a4	UTSW	9	106068384	missense	probably benign	0.00
R8530:Col6a4	UTSW	9	106080505	missense	probably benign	0.31
R8556:Col6a4	UTSW	9	106067053	missense	probably damaging	0.96
R8832:Col6a4	UTSW	9	106072154	missense	probably benign
R9001:Col6a4	UTSW	9	106067171	missense	probably benign	0.26
R9009:Col6a4	UTSW	9	106077205	missense	probably benign	0.38
R9069:Col6a4	UTSW	9	106074939	missense	possibly damaging	0.85
R9155:Col6a4	UTSW	9	106075010	missense	probably benign
R9175:Col6a4	UTSW	9	106080361	missense	probably benign
R9176:Col6a4	UTSW	9	106061556	missense	probably damaging	1.00
R9295:Col6a4	UTSW	9	106080535	missense	probably damaging	1.00
R9298:Col6a4	UTSW	9	106068335	missense	probably damaging	0.96
R9389:Col6a4	UTSW	9	106000784	missense	probably damaging	1.00
R9424:Col6a4	UTSW	9	106068072	missense	probably benign	0.30
R9576:Col6a4	UTSW	9	106068072	missense	probably benign	0.30
RF022:Col6a4	UTSW	9	106077008	missense	probably damaging	0.99
X0025:Col6a4	UTSW	9	106000455	missense	probably damaging	0.99
Z1176:Col6a4	UTSW	9	106000797	missense	probably benign
Z1176:Col6a4	UTSW	9	106000870	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAGTAAGGGAACTCTGTCAAGC -3'
(R):5'- CCAATGTCGTGTTTATCCTGTG -3'

Sequencing Primer
(F):5'- GGAACTCTGTCAAGCTATAAAAAGG -3'
(R):5'- TGTGAAGGCATTCTCCCAG -3'

Posted On

2019-10-07