Incidental Mutation 'R7418:Atp8b3'
ID575466
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7418 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80519584-80539124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80530092 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 308 (L308Q)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
Predicted Effect probably damaging
Transcript: ENSMUST00000020383
AA Change: L308Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: L308Q

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220326
AA Change: L308Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 T G 10: 91,023,835 H827P probably benign Het
Ccdc180 T C 4: 45,904,616 L404P probably damaging Het
Cdh13 G A 8: 119,312,525 G569R probably damaging Het
Clec14a G A 12: 58,268,647 T63I probably damaging Het
Cngb1 G T 8: 95,278,259 S487* probably null Het
Cog5 A T 12: 31,833,241 N390Y probably damaging Het
Col6a4 C T 9: 106,022,915 G1670S probably damaging Het
Daxx T A 17: 33,910,605 D53E probably benign Het
Dnah14 C T 1: 181,616,742 T539I possibly damaging Het
Dnajc2 A G 5: 21,760,624 probably null Het
Ehmt1 C T 2: 24,884,634 G53R probably benign Het
Eif2b1 T A 5: 124,576,830 N113Y probably benign Het
Eya3 A G 4: 132,680,848 T152A possibly damaging Het
Fam234b G A 6: 135,217,011 V221M probably benign Het
Fbxl13 T A 5: 21,581,983 T319S probably benign Het
Fchsd2 G T 7: 101,271,624 V479F possibly damaging Het
Fgd5 T C 6: 92,024,538 S905P probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Fxn C T 19: 24,280,496 V24I probably benign Het
Gapvd1 C T 2: 34,725,118 D456N probably benign Het
Gm128 C T 3: 95,240,567 V139M possibly damaging Het
Gm973 A G 1: 59,526,813 T64A probably damaging Het
Gtf2h5 T A 17: 6,084,628 N64K probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Haus6 A G 4: 86,594,773 S386P possibly damaging Het
Hsh2d A G 8: 72,196,794 probably null Het
Htt T C 5: 34,790,353 M125T possibly damaging Het
Inpp5d T A 1: 87,708,211 probably null Het
Ints4 G A 7: 97,490,972 A137T probably benign Het
Isl2 A G 9: 55,544,352 D263G probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Jpt1 A T 11: 115,498,269 L116Q probably damaging Het
Kansl2 A G 15: 98,531,894 S86P possibly damaging Het
Kat2b G T 17: 53,610,925 R104I possibly damaging Het
Kcna10 C A 3: 107,195,046 A331D probably benign Het
Kcnk3 G A 5: 30,622,331 V242M possibly damaging Het
Kdm4a A G 4: 118,160,243 L542P probably damaging Het
Kif20b T C 19: 34,929,687 F119L probably damaging Het
Krtcap3 A T 5: 31,252,537 H149L probably benign Het
Lhx4 A G 1: 155,710,259 V102A probably damaging Het
Luc7l T A 17: 26,253,182 probably benign Het
Myh15 G T 16: 49,155,537 A1323S possibly damaging Het
Myl1 T A 1: 66,926,179 R151S unknown Het
Naif1 A G 2: 32,452,571 S45G probably benign Het
Ndst4 C T 3: 125,708,151 T121I probably damaging Het
Neurod6 C T 6: 55,679,298 R118Q probably damaging Het
Npl A T 1: 153,537,511 probably null Het
Nr4a3 T C 4: 48,051,476 Y77H probably damaging Het
Olfr1254 A T 2: 89,788,976 C125* probably null Het
Olfr1270 T G 2: 90,149,487 D173A probably damaging Het
Pex11a G A 7: 79,742,987 probably benign Het
Rab44 T A 17: 29,140,496 F553I unknown Het
Sbf2 C T 7: 110,365,821 R1002H probably damaging Het
Sectm1a C A 11: 121,069,293 probably null Het
Slit3 G A 11: 35,686,428 V1163M possibly damaging Het
Sphk2 G A 7: 45,711,756 R275C probably damaging Het
Tango6 A G 8: 106,688,834 S96G probably benign Het
Tg A G 15: 66,696,583 E1373G probably damaging Het
Traf3ip1 T A 1: 91,507,736 probably null Het
Trp53 T C 11: 69,588,388 F131L probably damaging Het
Ttc21a A T 9: 119,959,051 E847D probably benign Het
Ttn A G 2: 76,772,447 F18477S probably damaging Het
Usp25 A T 16: 77,113,842 R929* probably null Het
Usp49 G T 17: 47,672,168 E33* probably null Het
Vmn1r63 A G 7: 5,803,555 V26A possibly damaging Het
Vmn1r74 A T 7: 11,847,154 Y127F possibly damaging Het
Wdfy3 C T 5: 101,957,500 V154I probably benign Het
Xdh A G 17: 73,913,965 S590P possibly damaging Het
Zkscan4 A G 13: 21,484,629 K446E probably damaging Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80526164 splice site probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 splice site probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 splice site probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 splice site probably benign
IGL02224:Atp8b3 APN 10 80525976 splice site probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80530586 missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80520084 missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80525785 missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80532578 missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80521801 unclassified probably null
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 nonsense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80534183 missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80529706 missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80523847 missense probably benign
R4518:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80536770 unclassified probably null
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R5990:Atp8b3 UTSW 10 80525697 missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 unclassified probably null
R6748:Atp8b3 UTSW 10 80525224 missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80526061 missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7051:Atp8b3 UTSW 10 80529718 missense probably damaging 0.99
R7052:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7426:Atp8b3 UTSW 10 80529629 critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80520146 missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80524406 missense probably damaging 0.99
R8077:Atp8b3 UTSW 10 80531024 missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80529816 missense not run
RF006:Atp8b3 UTSW 10 80526236 missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80531077 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGAACTCCGCACTGCAAGC -3'
(R):5'- TTAAAGACAGTGAGCCCCAG -3'

Sequencing Primer
(F):5'- TGCAAGCAGCCGAGCAC -3'
(R):5'- ACAGTGAGCCCCAGAGCTG -3'
Posted On2019-10-07