Mutagenetix > Incidental Mutations

Incidental Mutation 'R7418:Apaf1'

575467

Institutional Source

Beutler Lab

Gene Symbol

Apaf1

Ensembl Gene

ENSMUSG00000019979

Gene Name

apoptotic peptidase activating factor 1

Synonyms

Apaf1l, 6230400I06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7418 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90989311-91082770 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 91023835 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Proline at position 827 (H827P)

Ref Sequence

ENSEMBL: ENSMUSP00000020157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000162618]

Predicted Effect

probably benign
Transcript: ENSMUST00000020157
AA Change: H827P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: H827P

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.3e-22	PFAM
Pfam:NB-ARC	129	414	1.7e-77	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000159110
AA Change: H827P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: H827P

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.4e-21	PFAM
Pfam:NB-ARC	129	414	6.9e-71	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000162618
AA Change: H816P

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: H816P

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	1.1e-20	PFAM
Pfam:NB-ARC	118	403	8.8e-72	PFAM
WD40	593	632	1.35e-5	SMART
WD40	635	674	1.04e-11	SMART
WD40	677	718	2.98e-7	SMART
WD40	721	760	9.88e-13	SMART
WD40	769	814	1.28e1	SMART
WD40	817	857	1.43e0	SMART
WD40	860	899	3.24e-8	SMART
WD40	941	978	2.57e0	SMART
WD40	981	1020	1.09e-5	SMART
WD40	1022	1060	2.09e-2	SMART
WD40	1063	1102	2.93e-6	SMART
WD40	1105	1144	8.55e-8	SMART
WD40	1157	1193	4.55e-3	SMART
Blast:WD40	1196	1235	5e-18	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (66/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp8b3	A	T	10: 80,530,092	L308Q	probably damaging	Het
Ccdc180	T	C	4: 45,904,616	L404P	probably damaging	Het
Cdh13	G	A	8: 119,312,525	G569R	probably damaging	Het
Clec14a	G	A	12: 58,268,647	T63I	probably damaging	Het
Cngb1	G	T	8: 95,278,259	S487*	probably null	Het
Cog5	A	T	12: 31,833,241	N390Y	probably damaging	Het
Col6a4	C	T	9: 106,022,915	G1670S	probably damaging	Het
Daxx	T	A	17: 33,910,605	D53E	probably benign	Het
Dnah14	C	T	1: 181,616,742	T539I	possibly damaging	Het
Dnajc2	A	G	5: 21,760,624		probably null	Het
Ehmt1	C	T	2: 24,884,634	G53R	probably benign	Het
Eif2b1	T	A	5: 124,576,830	N113Y	probably benign	Het
Eya3	A	G	4: 132,680,848	T152A	possibly damaging	Het
Fam234b	G	A	6: 135,217,011	V221M	probably benign	Het
Fbxl13	T	A	5: 21,581,983	T319S	probably benign	Het
Fchsd2	G	T	7: 101,271,624	V479F	possibly damaging	Het
Fgd5	T	C	6: 92,024,538	S905P	probably benign	Het
Fthl17b	C	T	X: 8,962,804	R9Q	possibly damaging	Het
Fthl17b	C	T	X: 8,962,808	V8M	possibly damaging	Het
Fxn	C	T	19: 24,280,496	V24I	probably benign	Het
Gapvd1	C	T	2: 34,725,118	D456N	probably benign	Het
Gm128	C	T	3: 95,240,567	V139M	possibly damaging	Het
Gm973	A	G	1: 59,526,813	T64A	probably damaging	Het
Gtf2h5	T	A	17: 6,084,628	N64K	probably damaging	Het
H2bfm	G	A	X: 136,927,722	R120K	unknown	Het
Haus6	A	G	4: 86,594,773	S386P	possibly damaging	Het
Hsh2d	A	G	8: 72,196,794		probably null	Het
Htt	T	C	5: 34,790,353	M125T	possibly damaging	Het
Inpp5d	T	A	1: 87,708,211		probably null	Het
Ints4	G	A	7: 97,490,972	A137T	probably benign	Het
Isl2	A	G	9: 55,544,352	D263G	probably benign	Het
Itgb5	T	G	16: 33,885,094	D251E	probably damaging	Het
Jpt1	A	T	11: 115,498,269	L116Q	probably damaging	Het
Kansl2	A	G	15: 98,531,894	S86P	possibly damaging	Het
Kat2b	G	T	17: 53,610,925	R104I	possibly damaging	Het
Kcna10	C	A	3: 107,195,046	A331D	probably benign	Het
Kcnk3	G	A	5: 30,622,331	V242M	possibly damaging	Het
Kdm4a	A	G	4: 118,160,243	L542P	probably damaging	Het
Kif20b	T	C	19: 34,929,687	F119L	probably damaging	Het
Krtcap3	A	T	5: 31,252,537	H149L	probably benign	Het
Lhx4	A	G	1: 155,710,259	V102A	probably damaging	Het
Luc7l	T	A	17: 26,253,182		probably benign	Het
Myh15	G	T	16: 49,155,537	A1323S	possibly damaging	Het
Myl1	T	A	1: 66,926,179	R151S	unknown	Het
Naif1	A	G	2: 32,452,571	S45G	probably benign	Het
Ndst4	C	T	3: 125,708,151	T121I	probably damaging	Het
Neurod6	C	T	6: 55,679,298	R118Q	probably damaging	Het
Npl	A	T	1: 153,537,511		probably null	Het
Nr4a3	T	C	4: 48,051,476	Y77H	probably damaging	Het
Olfr1254	A	T	2: 89,788,976	C125*	probably null	Het
Olfr1270	T	G	2: 90,149,487	D173A	probably damaging	Het
Pex11a	G	A	7: 79,742,987		probably benign	Het
Rab44	T	A	17: 29,140,496	F553I	unknown	Het
Sbf2	C	T	7: 110,365,821	R1002H	probably damaging	Het
Sectm1a	C	A	11: 121,069,293		probably null	Het
Slit3	G	A	11: 35,686,428	V1163M	possibly damaging	Het
Sphk2	G	A	7: 45,711,756	R275C	probably damaging	Het
Tango6	A	G	8: 106,688,834	S96G	probably benign	Het
Tg	A	G	15: 66,696,583	E1373G	probably damaging	Het
Traf3ip1	T	A	1: 91,507,736		probably null	Het
Trp53	T	C	11: 69,588,388	F131L	probably damaging	Het
Ttc21a	A	T	9: 119,959,051	E847D	probably benign	Het
Ttn	A	G	2: 76,772,447	F18477S	probably damaging	Het
Usp25	A	T	16: 77,113,842	R929*	probably null	Het
Usp49	G	T	17: 47,672,168	E33*	probably null	Het
Vmn1r63	A	G	7: 5,803,555	V26A	possibly damaging	Het
Vmn1r74	A	T	7: 11,847,154	Y127F	possibly damaging	Het
Wdfy3	C	T	5: 101,957,500	V154I	probably benign	Het
Xdh	A	G	17: 73,913,965	S590P	possibly damaging	Het
Zkscan4	A	G	13: 21,484,629	K446E	probably damaging	Het

Other mutations in Apaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Apaf1	APN	10	91023788	missense	probably damaging	0.99
IGL00819:Apaf1	APN	10	90997340	splice site	probably null
IGL01481:Apaf1	APN	10	91031588	missense	possibly damaging	0.84
IGL01713:Apaf1	APN	10	91061832	splice site	probably benign
IGL01715:Apaf1	APN	10	91058354	missense	probably benign	0.20
IGL02152:Apaf1	APN	10	91061819	missense	probably benign	0.24
IGL02331:Apaf1	APN	10	91059619	missense	probably damaging	1.00
IGL03071:Apaf1	APN	10	90997255	missense	possibly damaging	0.88
IGL03101:Apaf1	APN	10	91031559	missense	possibly damaging	0.89
IGL03244:Apaf1	APN	10	91049349	splice site	probably benign
Mayhem	UTSW	10	90999719	missense	probably damaging	0.99
Wipeout	UTSW	10	91056000	missense	probably damaging	1.00
R0520:Apaf1	UTSW	10	91079989	missense	probably damaging	0.99
R0600:Apaf1	UTSW	10	91060052	missense	probably damaging	1.00
R0607:Apaf1	UTSW	10	91009203	missense	probably damaging	1.00
R0688:Apaf1	UTSW	10	91061705	missense	possibly damaging	0.94
R0734:Apaf1	UTSW	10	91037021	missense	probably benign	0.02
R1256:Apaf1	UTSW	10	91058406	missense	probably benign
R1459:Apaf1	UTSW	10	91062160	missense	probably benign	0.00
R1485:Apaf1	UTSW	10	91060243	missense	probably benign	0.02
R1511:Apaf1	UTSW	10	91060185	missense	possibly damaging	0.81
R1531:Apaf1	UTSW	10	91054521	missense	probably damaging	1.00
R1705:Apaf1	UTSW	10	91067271	splice site	probably benign
R1919:Apaf1	UTSW	10	91077614	nonsense	probably null
R1925:Apaf1	UTSW	10	90999719	missense	probably damaging	0.99
R2001:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2002:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2006:Apaf1	UTSW	10	91061772	missense	probably damaging	1.00
R2043:Apaf1	UTSW	10	91037028	missense	probably damaging	1.00
R2073:Apaf1	UTSW	10	91031694	nonsense	probably null
R2101:Apaf1	UTSW	10	91060080	missense	probably benign	0.26
R2130:Apaf1	UTSW	10	91060165	nonsense	probably null
R2153:Apaf1	UTSW	10	91048090	missense	probably damaging	1.00
R2377:Apaf1	UTSW	10	91079893	missense	possibly damaging	0.95
R2421:Apaf1	UTSW	10	91020723	missense	probably damaging	1.00
R3835:Apaf1	UTSW	10	91059587	missense	probably benign	0.07
R4750:Apaf1	UTSW	10	91060188	missense	probably damaging	1.00
R5100:Apaf1	UTSW	10	90997287	missense	probably benign
R5135:Apaf1	UTSW	10	91060094	missense	probably damaging	1.00
R5497:Apaf1	UTSW	10	90999656	missense	probably damaging	1.00
R5511:Apaf1	UTSW	10	91054392	missense	probably damaging	1.00
R5659:Apaf1	UTSW	10	91062153	nonsense	probably null
R5730:Apaf1	UTSW	10	91020771	missense	possibly damaging	0.62
R6176:Apaf1	UTSW	10	91059571	critical splice donor site	probably null
R6242:Apaf1	UTSW	10	91062163	missense	probably damaging	1.00
R6292:Apaf1	UTSW	10	90991563	missense	possibly damaging	0.86
R6376:Apaf1	UTSW	10	91023811	missense	probably damaging	1.00
R6534:Apaf1	UTSW	10	91056000	missense	probably damaging	1.00
R6975:Apaf1	UTSW	10	91020734	missense	probably damaging	0.97
R7218:Apaf1	UTSW	10	91037002	missense	probably damaging	1.00
R7369:Apaf1	UTSW	10	91001036	missense	probably damaging	0.97
R7409:Apaf1	UTSW	10	91067246	missense	probably damaging	1.00
R7413:Apaf1	UTSW	10	90995680	missense	probably benign	0.28
R7423:Apaf1	UTSW	10	91059606	missense	probably damaging	1.00
R7488:Apaf1	UTSW	10	91054380	missense	probably benign	0.35
R7765:Apaf1	UTSW	10	91023782	missense	probably benign	0.34
R7913:Apaf1	UTSW	10	91060271	missense	probably damaging	0.99
R7914:Apaf1	UTSW	10	91060233	missense	probably damaging	1.00
R7922:Apaf1	UTSW	10	90999753	missense	probably benign
R8131:Apaf1	UTSW	10	91077558	missense	possibly damaging	0.93
R8158:Apaf1	UTSW	10	91059658	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CAGCAGTTAAGGCATCCACC -3'
(R):5'- AACTTTATATGCCCCAGTACAGG -3'

Sequencing Primer
(F):5'- GTTAAGGCATCCACCCCTGC -3'
(R):5'- CCAGTACAGGGGAACACCAG -3'

Posted On

2019-10-07