Incidental Mutation 'R7418:Cog5'
ID 575471
Institutional Source Beutler Lab
Gene Symbol Cog5
Ensembl Gene ENSMUSG00000035933
Gene Name component of oligomeric golgi complex 5
Synonyms GTC90, GOLTC1, 5430405C01Rik
MMRRC Submission 045496-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.890) question?
Stock # R7418 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 31704868-31987629 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31883240 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 390 (N390Y)
Ref Sequence ENSEMBL: ENSMUSP00000044797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862]
AlphaFold Q8C0L8
Predicted Effect probably damaging
Transcript: ENSMUST00000036862
AA Change: N390Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933
AA Change: N390Y

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. The encoded protein is organized with conserved oligomeric Golgi complex components 6, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants. Mutations in this gene result in congenital disorder of glycosylation type 2I.[provided by RefSeq, Jan 2011]
Allele List at MGI

All alleles(99) : Gene trapped(99)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 T G 10: 90,859,697 (GRCm39) H827P probably benign Het
Atp8b3 A T 10: 80,365,926 (GRCm39) L308Q probably damaging Het
Ccdc180 T C 4: 45,904,616 (GRCm39) L404P probably damaging Het
Cdh13 G A 8: 120,039,264 (GRCm39) G569R probably damaging Het
Clec14a G A 12: 58,315,433 (GRCm39) T63I probably damaging Het
Cngb1 G T 8: 96,004,887 (GRCm39) S487* probably null Het
Col6a4 C T 9: 105,900,114 (GRCm39) G1670S probably damaging Het
Daxx T A 17: 34,129,579 (GRCm39) D53E probably benign Het
Dnah14 C T 1: 181,444,307 (GRCm39) T539I possibly damaging Het
Dnajc2 A G 5: 21,965,622 (GRCm39) probably null Het
Ehmt1 C T 2: 24,774,646 (GRCm39) G53R probably benign Het
Eif2b1 T A 5: 124,714,893 (GRCm39) N113Y probably benign Het
Eya3 A G 4: 132,408,159 (GRCm39) T152A possibly damaging Het
Fam234b G A 6: 135,194,009 (GRCm39) V221M probably benign Het
Fbxl13 T A 5: 21,786,981 (GRCm39) T319S probably benign Het
Fchsd2 G T 7: 100,920,831 (GRCm39) V479F possibly damaging Het
Fgd5 T C 6: 92,001,519 (GRCm39) S905P probably benign Het
Fthl17b C T X: 8,829,043 (GRCm39) R9Q possibly damaging Het
Fthl17b C T X: 8,829,047 (GRCm39) V8M possibly damaging Het
Fxn C T 19: 24,257,860 (GRCm39) V24I probably benign Het
Gapvd1 C T 2: 34,615,130 (GRCm39) D456N probably benign Het
Gm128 C T 3: 95,147,878 (GRCm39) V139M possibly damaging Het
Gm973 A G 1: 59,565,972 (GRCm39) T64A probably damaging Het
Gtf2h5 T A 17: 6,134,903 (GRCm39) N64K probably damaging Het
H2bw2 G A X: 135,828,471 (GRCm39) R120K unknown Het
Haus6 A G 4: 86,513,010 (GRCm39) S386P possibly damaging Het
Hsh2d A G 8: 72,950,638 (GRCm39) probably null Het
Htt T C 5: 34,947,697 (GRCm39) M125T possibly damaging Het
Inpp5d T A 1: 87,635,933 (GRCm39) probably null Het
Ints4 G A 7: 97,140,179 (GRCm39) A137T probably benign Het
Isl2 A G 9: 55,451,636 (GRCm39) D263G probably benign Het
Itgb5 T G 16: 33,705,464 (GRCm39) D251E probably damaging Het
Jpt1 A T 11: 115,389,095 (GRCm39) L116Q probably damaging Het
Kansl2 A G 15: 98,429,775 (GRCm39) S86P possibly damaging Het
Kat2b G T 17: 53,917,953 (GRCm39) R104I possibly damaging Het
Kcna10 C A 3: 107,102,362 (GRCm39) A331D probably benign Het
Kcnk3 G A 5: 30,779,675 (GRCm39) V242M possibly damaging Het
Kdm4a A G 4: 118,017,440 (GRCm39) L542P probably damaging Het
Kif20b T C 19: 34,907,087 (GRCm39) F119L probably damaging Het
Krtcap3 A T 5: 31,409,881 (GRCm39) H149L probably benign Het
Lhx4 A G 1: 155,586,005 (GRCm39) V102A probably damaging Het
Luc7l T A 17: 26,472,156 (GRCm39) probably benign Het
Myh15 G T 16: 48,975,900 (GRCm39) A1323S possibly damaging Het
Myl1 T A 1: 66,965,338 (GRCm39) R151S unknown Het
Naif1 A G 2: 32,342,583 (GRCm39) S45G probably benign Het
Ndst4 C T 3: 125,501,800 (GRCm39) T121I probably damaging Het
Neurod6 C T 6: 55,656,283 (GRCm39) R118Q probably damaging Het
Npl A T 1: 153,413,257 (GRCm39) probably null Het
Nr4a3 T C 4: 48,051,476 (GRCm39) Y77H probably damaging Het
Or4a81 A T 2: 89,619,320 (GRCm39) C125* probably null Het
Or4b1 T G 2: 89,979,831 (GRCm39) D173A probably damaging Het
Pex11a G A 7: 79,392,735 (GRCm39) probably benign Het
Rab44 T A 17: 29,359,470 (GRCm39) F553I unknown Het
Sbf2 C T 7: 109,965,028 (GRCm39) R1002H probably damaging Het
Sectm1a C A 11: 120,960,119 (GRCm39) probably null Het
Slit3 G A 11: 35,577,255 (GRCm39) V1163M possibly damaging Het
Sphk2 G A 7: 45,361,180 (GRCm39) R275C probably damaging Het
Tango6 A G 8: 107,415,466 (GRCm39) S96G probably benign Het
Tg A G 15: 66,568,432 (GRCm39) E1373G probably damaging Het
Traf3ip1 T A 1: 91,435,458 (GRCm39) probably null Het
Trp53 T C 11: 69,479,214 (GRCm39) F131L probably damaging Het
Ttc21a A T 9: 119,788,117 (GRCm39) E847D probably benign Het
Ttn A G 2: 76,602,791 (GRCm39) F18477S probably damaging Het
Usp25 A T 16: 76,910,730 (GRCm39) R929* probably null Het
Usp49 G T 17: 47,983,093 (GRCm39) E33* probably null Het
Vmn1r63 A G 7: 5,806,554 (GRCm39) V26A possibly damaging Het
Vmn1r74 A T 7: 11,581,081 (GRCm39) Y127F possibly damaging Het
Wdfy3 C T 5: 102,105,366 (GRCm39) V154I probably benign Het
Xdh A G 17: 74,220,960 (GRCm39) S590P possibly damaging Het
Zkscan4 A G 13: 21,668,799 (GRCm39) K446E probably damaging Het
Other mutations in Cog5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cog5 APN 12 31,735,703 (GRCm39) missense probably damaging 1.00
IGL00495:Cog5 APN 12 31,887,308 (GRCm39) missense probably benign 0.06
IGL00763:Cog5 APN 12 31,715,531 (GRCm39) splice site probably benign
IGL00789:Cog5 APN 12 31,810,951 (GRCm39) missense possibly damaging 0.95
IGL01288:Cog5 APN 12 31,936,205 (GRCm39) missense probably benign 0.13
IGL01315:Cog5 APN 12 31,810,985 (GRCm39) splice site probably benign
IGL01396:Cog5 APN 12 31,944,095 (GRCm39) missense probably benign 0.01
IGL02468:Cog5 APN 12 31,887,357 (GRCm39) critical splice donor site probably null
IGL03030:Cog5 APN 12 31,840,921 (GRCm39) missense probably damaging 0.99
IGL03346:Cog5 APN 12 31,944,037 (GRCm39) missense possibly damaging 0.88
R0201:Cog5 UTSW 12 31,889,840 (GRCm39) missense probably damaging 0.99
R0356:Cog5 UTSW 12 31,887,180 (GRCm39) splice site probably benign
R0492:Cog5 UTSW 12 31,919,460 (GRCm39) missense probably damaging 1.00
R0646:Cog5 UTSW 12 31,887,358 (GRCm39) splice site probably benign
R0971:Cog5 UTSW 12 31,969,677 (GRCm39) missense probably benign 0.11
R1158:Cog5 UTSW 12 31,920,056 (GRCm39) splice site probably benign
R1997:Cog5 UTSW 12 31,710,848 (GRCm39) missense possibly damaging 0.66
R2167:Cog5 UTSW 12 31,887,288 (GRCm39) missense probably damaging 0.99
R4414:Cog5 UTSW 12 31,710,853 (GRCm39) nonsense probably null
R4755:Cog5 UTSW 12 31,919,405 (GRCm39) splice site probably null
R4836:Cog5 UTSW 12 31,969,732 (GRCm39) missense probably benign 0.07
R5017:Cog5 UTSW 12 31,970,604 (GRCm39) missense probably benign 0.29
R5256:Cog5 UTSW 12 31,936,204 (GRCm39) missense probably benign
R5986:Cog5 UTSW 12 31,710,716 (GRCm39) missense probably benign 0.03
R6131:Cog5 UTSW 12 31,936,220 (GRCm39) missense possibly damaging 0.47
R6885:Cog5 UTSW 12 31,944,198 (GRCm39) missense probably damaging 1.00
R7056:Cog5 UTSW 12 31,715,468 (GRCm39) missense possibly damaging 0.65
R7177:Cog5 UTSW 12 31,810,888 (GRCm39) missense probably damaging 1.00
R7182:Cog5 UTSW 12 31,735,707 (GRCm39) missense probably damaging 1.00
R7445:Cog5 UTSW 12 31,969,671 (GRCm39) missense possibly damaging 0.64
R7585:Cog5 UTSW 12 31,810,888 (GRCm39) missense probably damaging 1.00
R8332:Cog5 UTSW 12 31,883,222 (GRCm39) nonsense probably null
R8722:Cog5 UTSW 12 31,969,703 (GRCm39) missense possibly damaging 0.82
R8781:Cog5 UTSW 12 31,883,249 (GRCm39) missense probably damaging 1.00
R8911:Cog5 UTSW 12 31,883,238 (GRCm39) missense probably damaging 1.00
R8979:Cog5 UTSW 12 31,840,894 (GRCm39) missense probably benign 0.00
R9153:Cog5 UTSW 12 31,710,810 (GRCm39) missense possibly damaging 0.87
X0062:Cog5 UTSW 12 31,735,691 (GRCm39) missense probably benign 0.01
Z1177:Cog5 UTSW 12 31,851,984 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTCAGATTATATGGGTTTCGAC -3'
(R):5'- GCTAAGCCACAGGTCAATTTAATC -3'

Sequencing Primer
(F):5'- ATCCAGTGAATTTCAAAGGTGTC -3'
(R):5'- CATTCCACAGACTTAGAAGCTTAG -3'
Posted On 2019-10-07