Incidental Mutation 'R7419:Kcnb2'
ID 575490
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Name potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms Kv2.2, 9630047L19Rik
MMRRC Submission 045497-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7419 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 15357478-15793974 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15781251 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 708 (S708P)
Ref Sequence ENSEMBL: ENSMUSP00000126656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
AlphaFold A6H8H5
Predicted Effect possibly damaging
Transcript: ENSMUST00000170146
AA Change: S708P

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000175681
AA Change: S708P

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: S708P

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,226,959 (GRCm39) S572P probably damaging Het
Abca13 T C 11: 9,247,833 (GRCm39) Y2527H probably damaging Het
Abcc5 A G 16: 20,241,173 (GRCm39) I4T possibly damaging Het
Adamts12 C T 15: 11,317,365 (GRCm39) T1355I probably benign Het
Aloxe3 A G 11: 69,018,353 (GRCm39) T117A probably benign Het
Asb15 A G 6: 24,556,555 (GRCm39) I17V probably benign Het
Atf2 A G 2: 73,672,777 (GRCm39) V194A probably benign Het
Capn7 T C 14: 31,071,779 (GRCm39) V221A probably benign Het
Ccdc107 A T 4: 43,493,512 (GRCm39) S28C probably benign Het
Cct4 C T 11: 22,946,420 (GRCm39) T162I probably benign Het
Cdc40 A T 10: 40,717,439 (GRCm39) H417Q probably damaging Het
Celf1 A G 2: 90,833,588 (GRCm39) I115V probably benign Het
Ces3a A G 8: 105,783,056 (GRCm39) Y395C probably damaging Het
Cfh C A 1: 140,033,204 (GRCm39) C798F probably damaging Het
Clstn3 T C 6: 124,435,088 (GRCm39) T313A probably benign Het
Crmp1 T A 5: 37,436,229 (GRCm39) M329K probably benign Het
Csf2ra C T 19: 61,215,491 (GRCm39) A76T possibly damaging Het
Cspg4 T A 9: 56,795,727 (GRCm39) V1154E possibly damaging Het
Cyp2a4 A T 7: 26,014,188 (GRCm39) N455I probably benign Het
Cyp4a32 T G 4: 115,468,234 (GRCm39) M268R probably benign Het
Dcaf13 T A 15: 38,993,615 (GRCm39) I236N probably damaging Het
Dennd2a A G 6: 39,500,397 (GRCm39) I56T probably damaging Het
Eif2d T A 1: 131,098,793 (GRCm39) S530R probably benign Het
Ep300 T A 15: 81,532,715 (GRCm39) M1651K unknown Het
Epha3 G A 16: 63,418,657 (GRCm39) T596I probably damaging Het
Fam171a2 C T 11: 102,329,628 (GRCm39) C377Y possibly damaging Het
Fat4 T A 3: 39,054,385 (GRCm39) N4142K probably damaging Het
Galnt5 C A 2: 57,904,937 (GRCm39) S500Y probably damaging Het
Gas6 A G 8: 13,521,456 (GRCm39) V431A probably benign Het
Gm7544 C T 1: 82,933,502 (GRCm39) C56Y unknown Het
Golgb1 T A 16: 36,733,281 (GRCm39) L884I possibly damaging Het
Gpatch2l T G 12: 86,312,025 (GRCm39) probably null Het
Gpr33 T C 12: 52,070,050 (GRCm39) T330A probably benign Het
H2bw2 G A X: 135,828,471 (GRCm39) R120K unknown Het
Ifi205 A G 1: 173,855,874 (GRCm39) M52T possibly damaging Het
Ino80 A T 2: 119,210,495 (GRCm39) D1346E probably benign Het
Ino80c T C 18: 24,241,836 (GRCm39) K183R unknown Het
Itgal G T 7: 126,906,047 (GRCm39) R379L probably benign Het
Itih3 T A 14: 30,636,730 (GRCm39) T582S probably benign Het
Kcnt1 A T 2: 25,806,011 (GRCm39) Y1200F probably benign Het
L3mbtl4 G A 17: 68,948,537 (GRCm39) D473N probably benign Het
Lama1 T G 17: 68,024,169 (GRCm39) I89R Het
Lama2 A G 10: 27,142,630 (GRCm39) I616T probably benign Het
Lipm A C 19: 34,093,881 (GRCm39) D266A probably benign Het
Lrrc4c A T 2: 97,460,106 (GRCm39) H244L probably benign Het
Lrrtm3 T C 10: 63,923,925 (GRCm39) E414G probably damaging Het
Ltbp4 A G 7: 27,029,192 (GRCm39) V231A unknown Het
Me3 G T 7: 89,385,927 (GRCm39) R92L probably damaging Het
Mroh7 T G 4: 106,541,115 (GRCm39) I1175L probably benign Het
Muc16 A G 9: 18,553,258 (GRCm39) M4345T probably benign Het
Mug2 A G 6: 122,017,529 (GRCm39) Y422C possibly damaging Het
N6amt1 T G 16: 87,164,454 (GRCm39) S214A possibly damaging Het
Ogfrl1 G A 1: 23,422,063 (GRCm39) Q24* probably null Het
Or12e14 A T 2: 87,677,406 (GRCm39) T264S probably benign Het
Or1ad6 T A 11: 50,860,152 (GRCm39) Y102* probably null Het
Or2ag2b T C 7: 106,417,551 (GRCm39) L87P possibly damaging Het
Or4f14 G A 2: 111,742,435 (GRCm39) P280L probably damaging Het
Or4k6 A C 14: 50,475,448 (GRCm39) V298G possibly damaging Het
Or4x13 A G 2: 90,231,803 (GRCm39) D266G probably damaging Het
Or6b6 A G 7: 106,571,353 (GRCm39) M66T probably benign Het
Or7g23 A C 9: 19,086,642 (GRCm39) M110R possibly damaging Het
Or8g23 T A 9: 38,971,465 (GRCm39) I166L probably benign Het
Or8k3 C T 2: 86,058,557 (GRCm39) G253R probably damaging Het
Oser1 A T 2: 163,253,364 (GRCm39) D48E probably benign Het
Piwil4 G A 9: 14,613,691 (GRCm39) P867L probably damaging Het
Pla2g6 C T 15: 79,189,898 (GRCm39) probably null Het
Plxna1 A G 6: 89,334,584 (GRCm39) L15P unknown Het
Ppan C T 9: 20,803,140 (GRCm39) T404I probably benign Het
Pros1 C A 16: 62,748,433 (GRCm39) Y635* probably null Het
Rabep2 G A 7: 126,043,342 (GRCm39) R414Q probably benign Het
Rbms3 T A 9: 116,651,894 (GRCm39) E201V probably damaging Het
Robo4 A C 9: 37,314,105 (GRCm39) I119L probably benign Het
S100b A T 10: 76,095,820 (GRCm39) D66V probably damaging Het
Serpina1f A G 12: 103,656,101 (GRCm39) S376P probably damaging Het
Slc24a4 T C 12: 102,193,350 (GRCm39) probably null Het
Slc30a6 T C 17: 74,730,424 (GRCm39) V438A probably benign Het
Sobp A G 10: 42,897,804 (GRCm39) S594P probably benign Het
Tcstv1b A G 13: 120,634,994 (GRCm39) E92G probably damaging Het
Tmem45b T C 9: 31,339,334 (GRCm39) D213G probably benign Het
Topbp1 T A 9: 103,200,543 (GRCm39) D525E probably benign Het
Trim30c G T 7: 104,037,472 (GRCm39) L165I probably benign Het
Unc13b A T 4: 43,174,023 (GRCm39) D1617V unknown Het
Ush1c A G 7: 45,878,679 (GRCm39) L112P probably damaging Het
Vipr1 T A 9: 121,490,539 (GRCm39) I195N probably damaging Het
Vmn2r38 A C 7: 9,078,354 (GRCm39) V676G probably damaging Het
Vmn2r87 A T 10: 130,307,992 (GRCm39) Y749N probably damaging Het
Vps13d A T 4: 144,842,073 (GRCm39) S2615R Het
Whrn A G 4: 63,334,330 (GRCm39) V828A possibly damaging Het
Zbp1 A G 2: 173,050,958 (GRCm39) V304A probably benign Het
Zeb2 A T 2: 44,886,359 (GRCm39) N899K probably benign Het
Zfp148 T C 16: 33,317,511 (GRCm39) S728P possibly damaging Het
Zfp518a T A 19: 40,902,207 (GRCm39) I712N possibly damaging Het
Zfp683 T C 4: 133,786,211 (GRCm39) V446A probably benign Het
Zranb3 A T 1: 127,891,588 (GRCm39) V796D possibly damaging Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15,781,236 (GRCm39) missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15,383,147 (GRCm39) missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15,781,048 (GRCm39) missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15,383,178 (GRCm39) missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15,781,033 (GRCm39) missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15,780,085 (GRCm39) missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15,781,159 (GRCm39) missense probably benign
IGL02526:Kcnb2 APN 1 15,780,979 (GRCm39) missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15,780,730 (GRCm39) missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15,781,435 (GRCm39) missense probably benign
IGL03144:Kcnb2 APN 1 15,780,112 (GRCm39) missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15,383,200 (GRCm39) missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15,783,137 (GRCm39) unclassified probably benign
R0538:Kcnb2 UTSW 1 15,783,108 (GRCm39) unclassified probably benign
R0611:Kcnb2 UTSW 1 15,780,664 (GRCm39) missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15,781,012 (GRCm39) missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15,779,979 (GRCm39) missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15,779,990 (GRCm39) missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15,781,540 (GRCm39) missense possibly damaging 0.82
R2444:Kcnb2 UTSW 1 15,779,791 (GRCm39) missense probably benign
R3025:Kcnb2 UTSW 1 15,781,059 (GRCm39) missense possibly damaging 0.87
R3886:Kcnb2 UTSW 1 15,780,639 (GRCm39) missense probably damaging 1.00
R5010:Kcnb2 UTSW 1 15,383,186 (GRCm39) missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15,779,724 (GRCm39) missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15,781,068 (GRCm39) missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15,781,716 (GRCm39) missense probably benign
R5926:Kcnb2 UTSW 1 15,383,235 (GRCm39) missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15,780,790 (GRCm39) missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15,781,436 (GRCm39) missense probably benign
R6724:Kcnb2 UTSW 1 15,780,664 (GRCm39) missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15,780,480 (GRCm39) missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15,383,150 (GRCm39) missense probably benign
R7352:Kcnb2 UTSW 1 15,780,835 (GRCm39) missense probably benign
R7425:Kcnb2 UTSW 1 15,780,031 (GRCm39) missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15,383,064 (GRCm39) missense probably damaging 1.00
R7978:Kcnb2 UTSW 1 15,780,837 (GRCm39) missense probably benign 0.15
R7983:Kcnb2 UTSW 1 15,383,004 (GRCm39) missense probably damaging 0.98
R8115:Kcnb2 UTSW 1 15,781,851 (GRCm39) makesense probably null
R8156:Kcnb2 UTSW 1 15,780,280 (GRCm39) missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15,781,777 (GRCm39) missense probably damaging 1.00
R8439:Kcnb2 UTSW 1 15,382,934 (GRCm39) missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15,780,876 (GRCm39) missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15,780,648 (GRCm39) missense probably benign 0.07
R9274:Kcnb2 UTSW 1 15,781,723 (GRCm39) missense probably benign
R9321:Kcnb2 UTSW 1 15,779,793 (GRCm39) missense possibly damaging 0.46
R9563:Kcnb2 UTSW 1 15,779,737 (GRCm39) missense probably damaging 1.00
R9633:Kcnb2 UTSW 1 15,781,444 (GRCm39) missense probably benign
R9709:Kcnb2 UTSW 1 15,780,523 (GRCm39) missense probably benign 0.31
V7580:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15,781,252 (GRCm39) missense probably benign 0.01
Z1088:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.03
Z1177:Kcnb2 UTSW 1 15,781,182 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCCAGGAACAGATGAGCAC -3'
(R):5'- TGACAGTGTGCCGAATCATCAG -3'

Sequencing Primer
(F):5'- GGCACCTCCATTCCTTACACTAAG -3'
(R):5'- GTGCCGAATCATCAGCCTCC -3'
Posted On 2019-10-07