Incidental Mutation 'R7419:Cfh'
ID575495
Institutional Source Beutler Lab
Gene Symbol Cfh
Ensembl Gene ENSMUSG00000026365
Gene Namecomplement component factor h
SynonymsMud-1, Sas1, Sas-1
MMRRC Submission
Accession Numbers

Genbank: NM_009888; MGI: 88385

Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R7419 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location140084708-140183764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 140105466 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 798 (C798F)
Ref Sequence ENSEMBL: ENSMUSP00000107607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066859] [ENSMUST00000111976] [ENSMUST00000111977] [ENSMUST00000123238] [ENSMUST00000192880]
Predicted Effect probably damaging
Transcript: ENSMUST00000066859
AA Change: C780F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066677
Gene: ENSMUSG00000026365
AA Change: C780F

DomainStartEndE-ValueType
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 569 622 5.56e-9 SMART
CCP 629 683 3.45e-14 SMART
CCP 690 743 1.82e-13 SMART
CCP 752 802 6.59e-1 SMART
CCP 808 861 1.04e-8 SMART
CCP 867 931 4.66e-11 SMART
CCP 936 989 3.9e-13 SMART
CCP 994 1048 1.4e-14 SMART
CCP 1053 1107 2.09e-13 SMART
CCP 1114 1168 8.04e-15 SMART
CCP 1172 1233 5.57e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111976
AA Change: C798F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107607
Gene: ENSMUSG00000026365
AA Change: C798F

DomainStartEndE-ValueType
CCP 39 98 7.75e-8 SMART
CCP 103 159 2.17e-11 SMART
CCP 164 223 7.5e-15 SMART
CCP 228 280 6.29e-8 SMART
CCP 285 338 2.04e-7 SMART
CCP 343 403 6.35e-4 SMART
CCP 407 460 1.15e-10 SMART
CCP 466 523 3.62e-8 SMART
CCP 527 582 6.45e-5 SMART
CCP 587 640 5.56e-9 SMART
CCP 647 701 3.45e-14 SMART
CCP 708 761 1.82e-13 SMART
CCP 770 820 6.59e-1 SMART
CCP 826 879 1.04e-8 SMART
CCP 885 949 4.66e-11 SMART
CCP 954 1007 3.9e-13 SMART
CCP 1012 1066 1.4e-14 SMART
CCP 1071 1125 2.09e-13 SMART
CCP 1132 1186 8.04e-15 SMART
CCP 1190 1251 5.57e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111977
AA Change: C741F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107608
Gene: ENSMUSG00000026365
AA Change: C741F

DomainStartEndE-ValueType
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 572 626 3.45e-14 SMART
CCP 633 686 1.82e-13 SMART
CCP 695 745 6.59e-1 SMART
CCP 751 804 1.04e-8 SMART
CCP 810 874 4.66e-11 SMART
CCP 879 932 3.9e-13 SMART
CCP 937 991 1.4e-14 SMART
CCP 996 1050 2.09e-13 SMART
CCP 1057 1111 8.04e-15 SMART
CCP 1115 1176 5.57e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123238
AA Change: C780F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115166
Gene: ENSMUSG00000026365
AA Change: C780F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 569 622 5.56e-9 SMART
CCP 629 683 3.45e-14 SMART
CCP 690 743 1.82e-13 SMART
CCP 752 802 6.59e-1 SMART
CCP 808 861 1.04e-8 SMART
CCP 867 931 4.66e-11 SMART
CCP 936 989 3.9e-13 SMART
CCP 994 1048 1.4e-14 SMART
CCP 1053 1107 2.09e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192880
SMART Domains Protein: ENSMUSP00000141209
Gene: ENSMUSG00000026365

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CCP 39 98 3.9e-10 SMART
CCP 103 159 1e-13 SMART
CCP 164 223 3.7e-17 SMART
CCP 228 280 3.1e-10 SMART
CCP 285 338 9.9e-10 SMART
CCP 343 403 3.2e-6 SMART
CCP 407 460 5.6e-13 SMART
CCP 467 521 6.7e-17 SMART
CCP 526 580 1e-15 SMART
CCP 587 641 3.8e-17 SMART
CCP 645 706 2.7e-2 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene results in markedly reduced serum C3, abnormal renal histology, spontaneous membranoproliferative glomerulonephritis (MPGN), hematuria, proteinuria, and increased mortality at 8 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,276,959 S572P probably damaging Het
Abca13 T C 11: 9,297,833 Y2527H probably damaging Het
Abcc5 A G 16: 20,422,423 I4T possibly damaging Het
Adamts12 C T 15: 11,317,279 T1355I probably benign Het
Aloxe3 A G 11: 69,127,527 T117A probably benign Het
Asb15 A G 6: 24,556,556 I17V probably benign Het
Atf2 A G 2: 73,842,433 V194A probably benign Het
Capn7 T C 14: 31,349,822 V221A probably benign Het
Ccdc107 A T 4: 43,493,512 S28C probably benign Het
Cct4 C T 11: 22,996,420 T162I probably benign Het
Cdc40 A T 10: 40,841,443 H417Q probably damaging Het
Celf1 A G 2: 91,003,243 I115V probably benign Het
Ces3a A G 8: 105,056,424 Y395C probably damaging Het
Clstn3 T C 6: 124,458,129 T313A probably benign Het
Crmp1 T A 5: 37,278,885 M329K probably benign Het
Csf2ra C T 19: 61,227,053 A76T possibly damaging Het
Cspg4 T A 9: 56,888,443 V1154E possibly damaging Het
Cyp2a4 A T 7: 26,314,763 N455I probably benign Het
Cyp4a32 T G 4: 115,611,037 M268R probably benign Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dennd2a A G 6: 39,523,463 I56T probably damaging Het
Eif2d T A 1: 131,171,056 S530R probably benign Het
Ep300 T A 15: 81,648,514 M1651K unknown Het
Epha3 G A 16: 63,598,294 T596I probably damaging Het
Fam171a2 C T 11: 102,438,802 C377Y possibly damaging Het
Fat4 T A 3: 39,000,236 N4142K probably damaging Het
Galnt5 C A 2: 58,014,925 S500Y probably damaging Het
Gas6 A G 8: 13,471,456 V431A probably benign Het
Gm21818 A G 13: 120,173,458 E92G probably damaging Het
Gm7544 C T 1: 82,955,781 C56Y unknown Het
Golgb1 T A 16: 36,912,919 L884I possibly damaging Het
Gpatch2l T G 12: 86,265,251 probably null Het
Gpr33 T C 12: 52,023,267 T330A probably benign Het
H2bfm G A X: 136,927,722 R120K unknown Het
Ifi205 A G 1: 174,028,308 M52T possibly damaging Het
Ino80 A T 2: 119,380,014 D1346E probably benign Het
Ino80c T C 18: 24,108,779 K183R unknown Het
Itgal G T 7: 127,306,875 R379L probably benign Het
Itih3 T A 14: 30,914,773 T582S probably benign Het
Kcnb2 T C 1: 15,711,027 S708P possibly damaging Het
Kcnt1 A T 2: 25,915,999 Y1200F probably benign Het
L3mbtl4 G A 17: 68,641,542 D473N probably benign Het
Lama1 T G 17: 67,717,174 I89R Het
Lama2 A G 10: 27,266,634 I616T probably benign Het
Lipm A C 19: 34,116,481 D266A probably benign Het
Lrrc4c A T 2: 97,629,761 H244L probably benign Het
Lrrtm3 T C 10: 64,088,146 E414G probably damaging Het
Ltbp4 A G 7: 27,329,767 V231A unknown Het
Me3 G T 7: 89,736,719 R92L probably damaging Het
Mroh7 T G 4: 106,683,918 I1175L probably benign Het
Muc16 A G 9: 18,641,962 M4345T probably benign Het
Mug2 A G 6: 122,040,570 Y422C possibly damaging Het
N6amt1 T G 16: 87,367,566 S214A possibly damaging Het
Ogfrl1 G A 1: 23,382,982 Q24* probably null Het
Olfr1047 C T 2: 86,228,213 G253R probably damaging Het
Olfr1150-ps1 A T 2: 87,847,062 T264S probably benign Het
Olfr1274-ps A G 2: 90,401,459 D266G probably damaging Het
Olfr1306 G A 2: 111,912,090 P280L probably damaging Het
Olfr1378 T A 11: 50,969,325 Y102* probably null Het
Olfr701 T C 7: 106,818,344 L87P possibly damaging Het
Olfr711 A G 7: 106,972,146 M66T probably benign Het
Olfr731 A C 14: 50,237,991 V298G possibly damaging Het
Olfr839-ps1 A C 9: 19,175,346 M110R possibly damaging Het
Olfr937 T A 9: 39,060,169 I166L probably benign Het
Oser1 A T 2: 163,411,444 D48E probably benign Het
Piwil4 G A 9: 14,702,395 P867L probably damaging Het
Pla2g6 C T 15: 79,305,698 probably null Het
Plxna1 A G 6: 89,357,602 L15P unknown Het
Ppan C T 9: 20,891,844 T404I probably benign Het
Pros1 C A 16: 62,928,070 Y635* probably null Het
Rabep2 G A 7: 126,444,170 R414Q probably benign Het
Rbms3 T A 9: 116,822,826 E201V probably damaging Het
Robo4 A C 9: 37,402,809 I119L probably benign Het
S100b A T 10: 76,259,986 D66V probably damaging Het
Serpina1f A G 12: 103,689,842 S376P probably damaging Het
Slc24a4 T C 12: 102,227,091 probably null Het
Slc30a6 T C 17: 74,423,429 V438A probably benign Het
Sobp A G 10: 43,021,808 S594P probably benign Het
Tmem45b T C 9: 31,428,038 D213G probably benign Het
Topbp1 T A 9: 103,323,344 D525E probably benign Het
Trim30c G T 7: 104,388,265 L165I probably benign Het
Unc13b A T 4: 43,174,023 D1617V unknown Het
Ush1c A G 7: 46,229,255 L112P probably damaging Het
Vipr1 T A 9: 121,661,473 I195N probably damaging Het
Vmn2r38 A C 7: 9,075,355 V676G probably damaging Het
Vmn2r87 A T 10: 130,472,123 Y749N probably damaging Het
Vps13d A T 4: 145,115,503 S2615R Het
Whrn A G 4: 63,416,093 V828A possibly damaging Het
Zbp1 A G 2: 173,209,165 V304A probably benign Het
Zeb2 A T 2: 44,996,347 N899K probably benign Het
Zfp148 T C 16: 33,497,141 S728P possibly damaging Het
Zfp518a T A 19: 40,913,763 I712N possibly damaging Het
Zfp683 T C 4: 134,058,900 V446A probably benign Het
Zranb3 A T 1: 127,963,851 V796D possibly damaging Het
Other mutations in Cfh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Cfh APN 1 140088682 missense probably damaging 1.00
IGL01124:Cfh APN 1 140183261 missense probably benign 0.01
IGL01389:Cfh APN 1 140154639 missense probably benign 0.44
IGL01455:Cfh APN 1 140105539 missense possibly damaging 0.51
IGL01877:Cfh APN 1 140100829 missense probably damaging 1.00
IGL02836:Cfh APN 1 140102399 missense probably damaging 1.00
IGL02937:Cfh APN 1 140105442 missense probably benign 0.19
IGL03039:Cfh APN 1 140136261 missense possibly damaging 0.86
IGL03069:Cfh APN 1 140099055 intron probably benign
IGL03192:Cfh APN 1 140099021 missense possibly damaging 0.71
IGL03201:Cfh APN 1 140102819 missense probably damaging 1.00
3-1:Cfh UTSW 1 140163125 missense probably damaging 1.00
PIT4449001:Cfh UTSW 1 140112565 missense probably damaging 1.00
R0257:Cfh UTSW 1 140144035 missense probably benign 0.01
R0294:Cfh UTSW 1 140183261 missense probably benign 0.01
R0571:Cfh UTSW 1 140102333 splice site probably null
R0576:Cfh UTSW 1 140136815 missense probably damaging 0.99
R0586:Cfh UTSW 1 140183182 missense probably damaging 0.98
R0605:Cfh UTSW 1 140102358 missense probably damaging 1.00
R0617:Cfh UTSW 1 140100883 missense probably benign 0.01
R0725:Cfh UTSW 1 140157343 splice site probably benign
R0853:Cfh UTSW 1 140105490 missense probably damaging 1.00
R1430:Cfh UTSW 1 140102698 splice site probably benign
R1500:Cfh UTSW 1 140100876 missense probably damaging 1.00
R1533:Cfh UTSW 1 140100978 missense possibly damaging 0.86
R1667:Cfh UTSW 1 140105523 missense probably benign 0.01
R1695:Cfh UTSW 1 140102837 missense probably damaging 0.98
R1728:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1729:Cfh UTSW 1 140136788 missense probably benign 0.02
R1729:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1730:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1739:Cfh UTSW 1 140136788 missense probably benign 0.02
R1739:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1756:Cfh UTSW 1 140100877 missense probably damaging 1.00
R1762:Cfh UTSW 1 140136788 missense probably benign 0.02
R1762:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1783:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1784:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1785:Cfh UTSW 1 140136788 missense probably benign 0.02
R1785:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1912:Cfh UTSW 1 140136141 splice site probably null
R2273:Cfh UTSW 1 140102825 missense probably damaging 1.00
R2288:Cfh UTSW 1 140098901 missense possibly damaging 0.70
R3725:Cfh UTSW 1 140086496 missense probably damaging 0.99
R3731:Cfh UTSW 1 140119970 missense possibly damaging 0.71
R4060:Cfh UTSW 1 140119926 missense possibly damaging 0.91
R4192:Cfh UTSW 1 140102716 missense possibly damaging 0.50
R4226:Cfh UTSW 1 140108926 missense probably damaging 1.00
R4425:Cfh UTSW 1 140100875 nonsense probably null
R4431:Cfh UTSW 1 140136266 missense probably damaging 1.00
R4712:Cfh UTSW 1 140108536 missense probably damaging 1.00
R4755:Cfh UTSW 1 140088808 missense probably damaging 1.00
R4792:Cfh UTSW 1 140100823 nonsense probably null
R4831:Cfh UTSW 1 140086387 missense probably benign
R5052:Cfh UTSW 1 140144044 missense probably damaging 0.96
R5181:Cfh UTSW 1 140147646 splice site probably benign
R5205:Cfh UTSW 1 140143970 missense probably damaging 1.00
R5285:Cfh UTSW 1 140100898 missense probably benign 0.21
R5366:Cfh UTSW 1 140136235 missense probably damaging 1.00
R5776:Cfh UTSW 1 140144023 missense possibly damaging 0.83
R5914:Cfh UTSW 1 140136229 missense probably benign 0.39
R5948:Cfh UTSW 1 140108808 missense probably damaging 0.96
R5979:Cfh UTSW 1 140118671 missense possibly damaging 0.66
R6034:Cfh UTSW 1 140163131 missense probably damaging 0.98
R6034:Cfh UTSW 1 140163131 missense probably damaging 0.98
R6059:Cfh UTSW 1 140118690 missense possibly damaging 0.92
R6198:Cfh UTSW 1 140105440 missense probably damaging 1.00
R6306:Cfh UTSW 1 140102417 missense probably damaging 1.00
R6523:Cfh UTSW 1 140101707 missense possibly damaging 0.82
R6610:Cfh UTSW 1 140101748 nonsense probably null
R6652:Cfh UTSW 1 140144068 missense probably benign 0.39
R6852:Cfh UTSW 1 140147749 missense probably damaging 1.00
R6861:Cfh UTSW 1 140100883 missense probably benign 0.07
R6862:Cfh UTSW 1 140102362 missense probably damaging 1.00
R7065:Cfh UTSW 1 140086402 missense probably damaging 0.99
R7191:Cfh UTSW 1 140112567 missense probably benign 0.04
R7197:Cfh UTSW 1 140088767 nonsense probably null
R7355:Cfh UTSW 1 140136815 missense probably damaging 1.00
R7367:Cfh UTSW 1 140086521 missense probably damaging 0.97
R7579:Cfh UTSW 1 140108590 missense possibly damaging 0.53
R7586:Cfh UTSW 1 140147721 missense probably damaging 0.99
R8119:Cfh UTSW 1 140120015 missense possibly damaging 0.95
T0975:Cfh UTSW 1 140154598 missense probably benign 0.05
Z1088:Cfh UTSW 1 140108904 missense probably benign 0.04
Z1088:Cfh UTSW 1 140147718 missense possibly damaging 0.77
Z1177:Cfh UTSW 1 140144059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATATAGGGCAGGATATCTGAATTA -3'
(R):5'- GCAGAATTTAGTGTACTAAGACATAGT -3'

Sequencing Primer
(F):5'- ATGAACTTAGTCCTGAGCTCATACC -3'
(R):5'- GACCAACTGGAGAAGTGTA -3'
Posted On2019-10-07