Incidental Mutation 'R7419:Zeb2'
ID575498
Institutional Source Beutler Lab
Gene Symbol Zeb2
Ensembl Gene ENSMUSG00000026872
Gene Namezinc finger E-box binding homeobox 2
SynonymsZfhx1b, Zfx1b, SIP1, 9130203F04Rik, D130016B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7419 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location44983632-45117395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44996347 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 899 (N899K)
Ref Sequence ENSEMBL: ENSMUSP00000028229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028229] [ENSMUST00000068415] [ENSMUST00000076836] [ENSMUST00000176438] [ENSMUST00000176732] [ENSMUST00000177302] [ENSMUST00000200844] [ENSMUST00000201804]
Predicted Effect probably benign
Transcript: ENSMUST00000028229
AA Change: N899K

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028229
Gene: ENSMUSG00000026872
AA Change: N899K

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068415
AA Change: N855K

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000069685
Gene: ENSMUSG00000026872
AA Change: N855K

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076836
AA Change: N854K

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076111
Gene: ENSMUSG00000026872
AA Change: N854K

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 210 233 2.09e-3 SMART
ZnF_C2H2 240 262 9.88e-5 SMART
ZnF_C2H2 281 303 4.87e-4 SMART
ZnF_C2H2 309 329 1.86e1 SMART
low complexity region 351 363 N/A INTRINSIC
ZnF_C2H2 580 600 5.54e1 SMART
HOX 643 705 2.05e-3 SMART
low complexity region 777 807 N/A INTRINSIC
low complexity region 840 855 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
ZnF_C2H2 998 1020 4.47e-3 SMART
ZnF_C2H2 1026 1048 2.17e-1 SMART
ZnF_C2H2 1054 1075 1.89e-1 SMART
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1133 1149 N/A INTRINSIC
low complexity region 1157 1167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176438
AA Change: N855K

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134849
Gene: ENSMUSG00000026872
AA Change: N855K

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176732
SMART Domains Protein: ENSMUSP00000135393
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
ZnF_C2H2 60 83 2.09e-3 SMART
ZnF_C2H2 90 112 9.88e-5 SMART
ZnF_C2H2 131 153 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177302
AA Change: N855K

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134747
Gene: ENSMUSG00000026872
AA Change: N855K

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200844
AA Change: N831K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144421
Gene: ENSMUSG00000026872
AA Change: N831K

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 187 210 9.2e-6 SMART
ZnF_C2H2 217 239 4.2e-7 SMART
ZnF_C2H2 258 280 2e-6 SMART
ZnF_C2H2 286 306 8e-2 SMART
low complexity region 328 340 N/A INTRINSIC
ZnF_C2H2 557 577 2.4e-1 SMART
HOX 620 682 1.1e-5 SMART
low complexity region 754 784 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
ZnF_C2H2 975 997 1.9e-5 SMART
ZnF_C2H2 1003 1025 9.6e-4 SMART
ZnF_C2H2 1031 1052 7.9e-4 SMART
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1110 1126 N/A INTRINSIC
low complexity region 1134 1144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201804
SMART Domains Protein: ENSMUSP00000144637
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
ZnF_C2H2 240 263 9.2e-6 SMART
ZnF_C2H2 270 292 4.2e-7 SMART
ZnF_C2H2 311 333 2e-6 SMART
ZnF_C2H2 339 359 8e-2 SMART
low complexity region 381 393 N/A INTRINSIC
ZnF_C2H2 610 630 2.4e-1 SMART
HOX 673 731 1.2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Zfh1 family of 2-handed zinc finger/homeodomain proteins. It is located in the nucleus and functions as a DNA-binding transcriptional repressor that interacts with activated SMADs. Mutations in this gene are associated with Hirschsprung disease/Mowat-Wilson syndrome. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous null mutants exhibit a variety of defects at embryonic day 8.5 and die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,276,959 S572P probably damaging Het
Abca13 T C 11: 9,297,833 Y2527H probably damaging Het
Abcc5 A G 16: 20,422,423 I4T possibly damaging Het
Adamts12 C T 15: 11,317,279 T1355I probably benign Het
Aloxe3 A G 11: 69,127,527 T117A probably benign Het
Asb15 A G 6: 24,556,556 I17V probably benign Het
Atf2 A G 2: 73,842,433 V194A probably benign Het
Capn7 T C 14: 31,349,822 V221A probably benign Het
Ccdc107 A T 4: 43,493,512 S28C probably benign Het
Cct4 C T 11: 22,996,420 T162I probably benign Het
Cdc40 A T 10: 40,841,443 H417Q probably damaging Het
Celf1 A G 2: 91,003,243 I115V probably benign Het
Ces3a A G 8: 105,056,424 Y395C probably damaging Het
Cfh C A 1: 140,105,466 C798F probably damaging Het
Clstn3 T C 6: 124,458,129 T313A probably benign Het
Crmp1 T A 5: 37,278,885 M329K probably benign Het
Csf2ra C T 19: 61,227,053 A76T possibly damaging Het
Cspg4 T A 9: 56,888,443 V1154E possibly damaging Het
Cyp2a4 A T 7: 26,314,763 N455I probably benign Het
Cyp4a32 T G 4: 115,611,037 M268R probably benign Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dennd2a A G 6: 39,523,463 I56T probably damaging Het
Eif2d T A 1: 131,171,056 S530R probably benign Het
Ep300 T A 15: 81,648,514 M1651K unknown Het
Epha3 G A 16: 63,598,294 T596I probably damaging Het
Fam171a2 C T 11: 102,438,802 C377Y possibly damaging Het
Fat4 T A 3: 39,000,236 N4142K probably damaging Het
Galnt5 C A 2: 58,014,925 S500Y probably damaging Het
Gas6 A G 8: 13,471,456 V431A probably benign Het
Gm21818 A G 13: 120,173,458 E92G probably damaging Het
Gm7544 C T 1: 82,955,781 C56Y unknown Het
Golgb1 T A 16: 36,912,919 L884I possibly damaging Het
Gpatch2l T G 12: 86,265,251 probably null Het
Gpr33 T C 12: 52,023,267 T330A probably benign Het
H2bfm G A X: 136,927,722 R120K unknown Het
Ifi205 A G 1: 174,028,308 M52T possibly damaging Het
Ino80 A T 2: 119,380,014 D1346E probably benign Het
Ino80c T C 18: 24,108,779 K183R unknown Het
Itgal G T 7: 127,306,875 R379L probably benign Het
Itih3 T A 14: 30,914,773 T582S probably benign Het
Kcnb2 T C 1: 15,711,027 S708P possibly damaging Het
Kcnt1 A T 2: 25,915,999 Y1200F probably benign Het
L3mbtl4 G A 17: 68,641,542 D473N probably benign Het
Lama1 T G 17: 67,717,174 I89R Het
Lama2 A G 10: 27,266,634 I616T probably benign Het
Lipm A C 19: 34,116,481 D266A probably benign Het
Lrrc4c A T 2: 97,629,761 H244L probably benign Het
Lrrtm3 T C 10: 64,088,146 E414G probably damaging Het
Ltbp4 A G 7: 27,329,767 V231A unknown Het
Me3 G T 7: 89,736,719 R92L probably damaging Het
Mroh7 T G 4: 106,683,918 I1175L probably benign Het
Muc16 A G 9: 18,641,962 M4345T probably benign Het
Mug2 A G 6: 122,040,570 Y422C possibly damaging Het
N6amt1 T G 16: 87,367,566 S214A possibly damaging Het
Ogfrl1 G A 1: 23,382,982 Q24* probably null Het
Olfr1047 C T 2: 86,228,213 G253R probably damaging Het
Olfr1150-ps1 A T 2: 87,847,062 T264S probably benign Het
Olfr1274-ps A G 2: 90,401,459 D266G probably damaging Het
Olfr1306 G A 2: 111,912,090 P280L probably damaging Het
Olfr1378 T A 11: 50,969,325 Y102* probably null Het
Olfr701 T C 7: 106,818,344 L87P possibly damaging Het
Olfr711 A G 7: 106,972,146 M66T probably benign Het
Olfr731 A C 14: 50,237,991 V298G possibly damaging Het
Olfr839-ps1 A C 9: 19,175,346 M110R possibly damaging Het
Olfr937 T A 9: 39,060,169 I166L probably benign Het
Oser1 A T 2: 163,411,444 D48E probably benign Het
Piwil4 G A 9: 14,702,395 P867L probably damaging Het
Pla2g6 C T 15: 79,305,698 probably null Het
Plxna1 A G 6: 89,357,602 L15P unknown Het
Ppan C T 9: 20,891,844 T404I probably benign Het
Pros1 C A 16: 62,928,070 Y635* probably null Het
Rabep2 G A 7: 126,444,170 R414Q probably benign Het
Rbms3 T A 9: 116,822,826 E201V probably damaging Het
Robo4 A C 9: 37,402,809 I119L probably benign Het
S100b A T 10: 76,259,986 D66V probably damaging Het
Serpina1f A G 12: 103,689,842 S376P probably damaging Het
Slc24a4 T C 12: 102,227,091 probably null Het
Slc30a6 T C 17: 74,423,429 V438A probably benign Het
Sobp A G 10: 43,021,808 S594P probably benign Het
Tmem45b T C 9: 31,428,038 D213G probably benign Het
Topbp1 T A 9: 103,323,344 D525E probably benign Het
Trim30c G T 7: 104,388,265 L165I probably benign Het
Unc13b A T 4: 43,174,023 D1617V unknown Het
Ush1c A G 7: 46,229,255 L112P probably damaging Het
Vipr1 T A 9: 121,661,473 I195N probably damaging Het
Vmn2r38 A C 7: 9,075,355 V676G probably damaging Het
Vmn2r87 A T 10: 130,472,123 Y749N probably damaging Het
Vps13d A T 4: 145,115,503 S2615R Het
Whrn A G 4: 63,416,093 V828A possibly damaging Het
Zbp1 A G 2: 173,209,165 V304A probably benign Het
Zfp148 T C 16: 33,497,141 S728P possibly damaging Het
Zfp518a T A 19: 40,913,763 I712N possibly damaging Het
Zfp683 T C 4: 134,058,900 V446A probably benign Het
Zranb3 A T 1: 127,963,851 V796D possibly damaging Het
Other mutations in Zeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Zeb2 APN 2 44997275 missense probably damaging 1.00
IGL01639:Zeb2 APN 2 44997257 missense probably benign
IGL02016:Zeb2 APN 2 44988874 missense possibly damaging 0.71
IGL02337:Zeb2 APN 2 44997230 missense probably damaging 0.96
IGL02745:Zeb2 APN 2 44994475 unclassified probably benign
IGL02893:Zeb2 APN 2 44996607 missense probably benign 0.03
IGL03412:Zeb2 APN 2 45002708 intron probably benign
Dropped UTSW 2 45110041 missense possibly damaging 0.66
Okapi UTSW 2 44997156 missense probably damaging 1.00
sable UTSW 2 44997318 missense probably damaging 1.00
R0514:Zeb2 UTSW 2 45002647 missense possibly damaging 0.52
R0603:Zeb2 UTSW 2 45017426 missense probably benign 0.45
R0608:Zeb2 UTSW 2 44996126 missense possibly damaging 0.87
R1236:Zeb2 UTSW 2 44994646 missense probably damaging 1.00
R1529:Zeb2 UTSW 2 44997194 missense probably damaging 1.00
R1581:Zeb2 UTSW 2 44997000 missense probably damaging 0.99
R1636:Zeb2 UTSW 2 45002611 missense probably damaging 1.00
R1924:Zeb2 UTSW 2 45002612 missense probably damaging 1.00
R2012:Zeb2 UTSW 2 44997950 missense probably damaging 1.00
R2097:Zeb2 UTSW 2 44997156 missense probably damaging 1.00
R2156:Zeb2 UTSW 2 44988809 missense probably benign 0.20
R4385:Zeb2 UTSW 2 45023062 missense probably damaging 1.00
R4472:Zeb2 UTSW 2 45023011 missense probably damaging 1.00
R4678:Zeb2 UTSW 2 44996341 missense probably damaging 0.99
R4769:Zeb2 UTSW 2 44996435 missense probably damaging 1.00
R4816:Zeb2 UTSW 2 44997768 missense probably damaging 0.99
R4918:Zeb2 UTSW 2 44996882 missense probably damaging 1.00
R4969:Zeb2 UTSW 2 44998919 missense probably damaging 1.00
R5191:Zeb2 UTSW 2 45002600 missense probably benign 0.00
R5195:Zeb2 UTSW 2 45001635 missense probably damaging 1.00
R5322:Zeb2 UTSW 2 44997095 missense probably damaging 1.00
R5699:Zeb2 UTSW 2 44997788 missense probably damaging 1.00
R5750:Zeb2 UTSW 2 44997518 missense probably damaging 0.96
R5764:Zeb2 UTSW 2 44996919 missense possibly damaging 0.89
R5914:Zeb2 UTSW 2 44997052 missense probably benign 0.00
R5918:Zeb2 UTSW 2 45111259 intron probably benign
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6302:Zeb2 UTSW 2 44997759 missense probably benign 0.18
R6372:Zeb2 UTSW 2 45002539 missense probably damaging 1.00
R6402:Zeb2 UTSW 2 44996975 missense probably damaging 1.00
R6492:Zeb2 UTSW 2 45110496 intron probably benign
R6554:Zeb2 UTSW 2 44997512 missense probably damaging 1.00
R6675:Zeb2 UTSW 2 44997445 nonsense probably null
R6735:Zeb2 UTSW 2 45110016 missense probably null 0.99
R6870:Zeb2 UTSW 2 44988910 missense probably damaging 0.98
R6925:Zeb2 UTSW 2 44994529 missense probably damaging 1.00
R6963:Zeb2 UTSW 2 44988799 missense probably damaging 0.97
R6972:Zeb2 UTSW 2 44997318 missense probably damaging 1.00
R7144:Zeb2 UTSW 2 45110041 missense possibly damaging 0.66
R7178:Zeb2 UTSW 2 44996994 missense probably damaging 0.97
R7379:Zeb2 UTSW 2 45001817 splice site probably null
R7580:Zeb2 UTSW 2 44994532 missense probably damaging 1.00
R7599:Zeb2 UTSW 2 44994613 missense probably damaging 1.00
R7625:Zeb2 UTSW 2 45002572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGTAGGAAGCTCATCTGATC -3'
(R):5'- GCTCGTACACTCCAAATAGCTTC -3'

Sequencing Primer
(F):5'- GTAGGAAGCTCATCTGATCCAGTC -3'
(R):5'- TTCTCTTCCGAGGAGCTGCAG -3'
Posted On2019-10-07