Incidental Mutation 'R7419:Mroh7'
ID 575514
Institutional Source Beutler Lab
Gene Symbol Mroh7
Ensembl Gene ENSMUSG00000047502
Gene Name maestro heat-like repeat family member 7
Synonyms Heatr8, Gm1027, LOC381538
MMRRC Submission 045497-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7419 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 106537614-106588122 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 106541115 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1175 (I1175L)
Ref Sequence ENSEMBL: ENSMUSP00000102382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026480] [ENSMUST00000106770]
AlphaFold A2AVR2
Predicted Effect probably benign
Transcript: ENSMUST00000026480
SMART Domains Protein: ENSMUSP00000026480
Gene: ENSMUSG00000025413

DomainStartEndE-ValueType
TPR 79 112 1.26e1 SMART
TPR 117 150 7.27e0 SMART
TPR 151 184 3.07e1 SMART
low complexity region 235 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106770
AA Change: I1175L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: I1175L

DomainStartEndE-ValueType
low complexity region 39 61 N/A INTRINSIC
low complexity region 318 332 N/A INTRINSIC
low complexity region 563 573 N/A INTRINSIC
SCOP:d1b3ua_ 634 1218 6e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,226,959 (GRCm39) S572P probably damaging Het
Abca13 T C 11: 9,247,833 (GRCm39) Y2527H probably damaging Het
Abcc5 A G 16: 20,241,173 (GRCm39) I4T possibly damaging Het
Adamts12 C T 15: 11,317,365 (GRCm39) T1355I probably benign Het
Aloxe3 A G 11: 69,018,353 (GRCm39) T117A probably benign Het
Asb15 A G 6: 24,556,555 (GRCm39) I17V probably benign Het
Atf2 A G 2: 73,672,777 (GRCm39) V194A probably benign Het
Capn7 T C 14: 31,071,779 (GRCm39) V221A probably benign Het
Ccdc107 A T 4: 43,493,512 (GRCm39) S28C probably benign Het
Cct4 C T 11: 22,946,420 (GRCm39) T162I probably benign Het
Cdc40 A T 10: 40,717,439 (GRCm39) H417Q probably damaging Het
Celf1 A G 2: 90,833,588 (GRCm39) I115V probably benign Het
Ces3a A G 8: 105,783,056 (GRCm39) Y395C probably damaging Het
Cfh C A 1: 140,033,204 (GRCm39) C798F probably damaging Het
Clstn3 T C 6: 124,435,088 (GRCm39) T313A probably benign Het
Crmp1 T A 5: 37,436,229 (GRCm39) M329K probably benign Het
Csf2ra C T 19: 61,215,491 (GRCm39) A76T possibly damaging Het
Cspg4 T A 9: 56,795,727 (GRCm39) V1154E possibly damaging Het
Cyp2a4 A T 7: 26,014,188 (GRCm39) N455I probably benign Het
Cyp4a32 T G 4: 115,468,234 (GRCm39) M268R probably benign Het
Dcaf13 T A 15: 38,993,615 (GRCm39) I236N probably damaging Het
Dennd2a A G 6: 39,500,397 (GRCm39) I56T probably damaging Het
Eif2d T A 1: 131,098,793 (GRCm39) S530R probably benign Het
Ep300 T A 15: 81,532,715 (GRCm39) M1651K unknown Het
Epha3 G A 16: 63,418,657 (GRCm39) T596I probably damaging Het
Fam171a2 C T 11: 102,329,628 (GRCm39) C377Y possibly damaging Het
Fat4 T A 3: 39,054,385 (GRCm39) N4142K probably damaging Het
Galnt5 C A 2: 57,904,937 (GRCm39) S500Y probably damaging Het
Gas6 A G 8: 13,521,456 (GRCm39) V431A probably benign Het
Gm7544 C T 1: 82,933,502 (GRCm39) C56Y unknown Het
Golgb1 T A 16: 36,733,281 (GRCm39) L884I possibly damaging Het
Gpatch2l T G 12: 86,312,025 (GRCm39) probably null Het
Gpr33 T C 12: 52,070,050 (GRCm39) T330A probably benign Het
H2bw2 G A X: 135,828,471 (GRCm39) R120K unknown Het
Ifi205 A G 1: 173,855,874 (GRCm39) M52T possibly damaging Het
Ino80 A T 2: 119,210,495 (GRCm39) D1346E probably benign Het
Ino80c T C 18: 24,241,836 (GRCm39) K183R unknown Het
Itgal G T 7: 126,906,047 (GRCm39) R379L probably benign Het
Itih3 T A 14: 30,636,730 (GRCm39) T582S probably benign Het
Kcnb2 T C 1: 15,781,251 (GRCm39) S708P possibly damaging Het
Kcnt1 A T 2: 25,806,011 (GRCm39) Y1200F probably benign Het
L3mbtl4 G A 17: 68,948,537 (GRCm39) D473N probably benign Het
Lama1 T G 17: 68,024,169 (GRCm39) I89R Het
Lama2 A G 10: 27,142,630 (GRCm39) I616T probably benign Het
Lipm A C 19: 34,093,881 (GRCm39) D266A probably benign Het
Lrrc4c A T 2: 97,460,106 (GRCm39) H244L probably benign Het
Lrrtm3 T C 10: 63,923,925 (GRCm39) E414G probably damaging Het
Ltbp4 A G 7: 27,029,192 (GRCm39) V231A unknown Het
Me3 G T 7: 89,385,927 (GRCm39) R92L probably damaging Het
Muc16 A G 9: 18,553,258 (GRCm39) M4345T probably benign Het
Mug2 A G 6: 122,017,529 (GRCm39) Y422C possibly damaging Het
N6amt1 T G 16: 87,164,454 (GRCm39) S214A possibly damaging Het
Ogfrl1 G A 1: 23,422,063 (GRCm39) Q24* probably null Het
Or12e14 A T 2: 87,677,406 (GRCm39) T264S probably benign Het
Or1ad6 T A 11: 50,860,152 (GRCm39) Y102* probably null Het
Or2ag2b T C 7: 106,417,551 (GRCm39) L87P possibly damaging Het
Or4f14 G A 2: 111,742,435 (GRCm39) P280L probably damaging Het
Or4k6 A C 14: 50,475,448 (GRCm39) V298G possibly damaging Het
Or4x13 A G 2: 90,231,803 (GRCm39) D266G probably damaging Het
Or6b6 A G 7: 106,571,353 (GRCm39) M66T probably benign Het
Or7g23 A C 9: 19,086,642 (GRCm39) M110R possibly damaging Het
Or8g23 T A 9: 38,971,465 (GRCm39) I166L probably benign Het
Or8k3 C T 2: 86,058,557 (GRCm39) G253R probably damaging Het
Oser1 A T 2: 163,253,364 (GRCm39) D48E probably benign Het
Piwil4 G A 9: 14,613,691 (GRCm39) P867L probably damaging Het
Pla2g6 C T 15: 79,189,898 (GRCm39) probably null Het
Plxna1 A G 6: 89,334,584 (GRCm39) L15P unknown Het
Ppan C T 9: 20,803,140 (GRCm39) T404I probably benign Het
Pros1 C A 16: 62,748,433 (GRCm39) Y635* probably null Het
Rabep2 G A 7: 126,043,342 (GRCm39) R414Q probably benign Het
Rbms3 T A 9: 116,651,894 (GRCm39) E201V probably damaging Het
Robo4 A C 9: 37,314,105 (GRCm39) I119L probably benign Het
S100b A T 10: 76,095,820 (GRCm39) D66V probably damaging Het
Serpina1f A G 12: 103,656,101 (GRCm39) S376P probably damaging Het
Slc24a4 T C 12: 102,193,350 (GRCm39) probably null Het
Slc30a6 T C 17: 74,730,424 (GRCm39) V438A probably benign Het
Sobp A G 10: 42,897,804 (GRCm39) S594P probably benign Het
Tcstv1b A G 13: 120,634,994 (GRCm39) E92G probably damaging Het
Tmem45b T C 9: 31,339,334 (GRCm39) D213G probably benign Het
Topbp1 T A 9: 103,200,543 (GRCm39) D525E probably benign Het
Trim30c G T 7: 104,037,472 (GRCm39) L165I probably benign Het
Unc13b A T 4: 43,174,023 (GRCm39) D1617V unknown Het
Ush1c A G 7: 45,878,679 (GRCm39) L112P probably damaging Het
Vipr1 T A 9: 121,490,539 (GRCm39) I195N probably damaging Het
Vmn2r38 A C 7: 9,078,354 (GRCm39) V676G probably damaging Het
Vmn2r87 A T 10: 130,307,992 (GRCm39) Y749N probably damaging Het
Vps13d A T 4: 144,842,073 (GRCm39) S2615R Het
Whrn A G 4: 63,334,330 (GRCm39) V828A possibly damaging Het
Zbp1 A G 2: 173,050,958 (GRCm39) V304A probably benign Het
Zeb2 A T 2: 44,886,359 (GRCm39) N899K probably benign Het
Zfp148 T C 16: 33,317,511 (GRCm39) S728P possibly damaging Het
Zfp518a T A 19: 40,902,207 (GRCm39) I712N possibly damaging Het
Zfp683 T C 4: 133,786,211 (GRCm39) V446A probably benign Het
Zranb3 A T 1: 127,891,588 (GRCm39) V796D possibly damaging Het
Other mutations in Mroh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Mroh7 APN 4 106,560,358 (GRCm39) missense probably benign 0.00
IGL01729:Mroh7 APN 4 106,561,402 (GRCm39) missense possibly damaging 0.66
IGL01834:Mroh7 APN 4 106,538,071 (GRCm39) missense probably benign 0.00
IGL02003:Mroh7 APN 4 106,559,726 (GRCm39) missense probably damaging 0.96
IGL02135:Mroh7 APN 4 106,559,707 (GRCm39) missense probably damaging 1.00
IGL02335:Mroh7 APN 4 106,564,979 (GRCm39) missense probably damaging 1.00
IGL02532:Mroh7 APN 4 106,577,788 (GRCm39) missense probably benign 0.04
IGL02896:Mroh7 APN 4 106,557,013 (GRCm39) missense possibly damaging 0.94
IGL03066:Mroh7 APN 4 106,549,595 (GRCm39) missense possibly damaging 0.85
IGL03298:Mroh7 APN 4 106,571,288 (GRCm39) nonsense probably null
holy UTSW 4 106,567,152 (GRCm39) splice site probably null
moley UTSW 4 106,551,509 (GRCm39) splice site probably null
P0016:Mroh7 UTSW 4 106,565,054 (GRCm39) critical splice acceptor site probably null
R0019:Mroh7 UTSW 4 106,578,623 (GRCm39) missense probably benign 0.07
R0094:Mroh7 UTSW 4 106,560,381 (GRCm39) missense probably damaging 0.98
R0105:Mroh7 UTSW 4 106,568,467 (GRCm39) missense possibly damaging 0.49
R0105:Mroh7 UTSW 4 106,568,467 (GRCm39) missense possibly damaging 0.49
R0515:Mroh7 UTSW 4 106,548,861 (GRCm39) missense probably benign 0.01
R0828:Mroh7 UTSW 4 106,557,073 (GRCm39) missense probably damaging 0.99
R0831:Mroh7 UTSW 4 106,537,990 (GRCm39) missense possibly damaging 0.92
R1107:Mroh7 UTSW 4 106,564,791 (GRCm39) splice site probably null
R1301:Mroh7 UTSW 4 106,577,692 (GRCm39) missense probably damaging 0.99
R1456:Mroh7 UTSW 4 106,552,338 (GRCm39) splice site probably benign
R1491:Mroh7 UTSW 4 106,560,255 (GRCm39) missense probably benign 0.11
R1540:Mroh7 UTSW 4 106,560,273 (GRCm39) missense probably benign 0.11
R1560:Mroh7 UTSW 4 106,568,451 (GRCm39) missense possibly damaging 0.78
R1645:Mroh7 UTSW 4 106,577,865 (GRCm39) missense probably benign 0.19
R1804:Mroh7 UTSW 4 106,551,589 (GRCm39) missense possibly damaging 0.76
R2162:Mroh7 UTSW 4 106,557,378 (GRCm39) missense probably damaging 0.96
R2265:Mroh7 UTSW 4 106,578,124 (GRCm39) missense probably benign 0.01
R2866:Mroh7 UTSW 4 106,548,287 (GRCm39) missense probably damaging 1.00
R3716:Mroh7 UTSW 4 106,561,407 (GRCm39) missense probably benign 0.25
R3718:Mroh7 UTSW 4 106,561,407 (GRCm39) missense probably benign 0.25
R4530:Mroh7 UTSW 4 106,577,634 (GRCm39) missense possibly damaging 0.71
R4661:Mroh7 UTSW 4 106,548,710 (GRCm39) critical splice donor site probably null
R4706:Mroh7 UTSW 4 106,548,821 (GRCm39) missense possibly damaging 0.86
R4910:Mroh7 UTSW 4 106,567,152 (GRCm39) splice site probably null
R4965:Mroh7 UTSW 4 106,548,184 (GRCm39) missense possibly damaging 0.77
R4969:Mroh7 UTSW 4 106,538,070 (GRCm39) missense probably benign
R4971:Mroh7 UTSW 4 106,548,749 (GRCm39) missense probably benign 0.04
R5083:Mroh7 UTSW 4 106,547,515 (GRCm39) missense probably benign 0.03
R5207:Mroh7 UTSW 4 106,578,583 (GRCm39) missense probably damaging 0.97
R5364:Mroh7 UTSW 4 106,548,840 (GRCm39) missense probably benign 0.10
R5392:Mroh7 UTSW 4 106,568,448 (GRCm39) critical splice donor site probably null
R5630:Mroh7 UTSW 4 106,577,764 (GRCm39) missense possibly damaging 0.71
R5691:Mroh7 UTSW 4 106,559,815 (GRCm39) missense probably damaging 0.96
R5703:Mroh7 UTSW 4 106,565,757 (GRCm39) missense possibly damaging 0.77
R5707:Mroh7 UTSW 4 106,539,082 (GRCm39) missense possibly damaging 0.73
R5919:Mroh7 UTSW 4 106,551,509 (GRCm39) splice site probably null
R5979:Mroh7 UTSW 4 106,578,123 (GRCm39) missense probably benign 0.00
R6479:Mroh7 UTSW 4 106,560,385 (GRCm39) missense possibly damaging 0.75
R6520:Mroh7 UTSW 4 106,578,460 (GRCm39) missense probably benign 0.00
R6657:Mroh7 UTSW 4 106,559,697 (GRCm39) nonsense probably null
R6732:Mroh7 UTSW 4 106,537,910 (GRCm39) frame shift probably null
R6817:Mroh7 UTSW 4 106,571,312 (GRCm39) missense probably benign 0.00
R6980:Mroh7 UTSW 4 106,557,434 (GRCm39) missense probably benign 0.05
R7062:Mroh7 UTSW 4 106,541,177 (GRCm39) missense probably damaging 1.00
R7116:Mroh7 UTSW 4 106,568,517 (GRCm39) missense probably benign 0.07
R7134:Mroh7 UTSW 4 106,577,791 (GRCm39) missense probably damaging 0.99
R7169:Mroh7 UTSW 4 106,548,836 (GRCm39) missense probably damaging 0.99
R7516:Mroh7 UTSW 4 106,548,316 (GRCm39) missense probably benign 0.00
R7525:Mroh7 UTSW 4 106,566,899 (GRCm39) missense probably benign 0.22
R7540:Mroh7 UTSW 4 106,577,595 (GRCm39) missense possibly damaging 0.85
R7849:Mroh7 UTSW 4 106,578,287 (GRCm39) missense probably benign
R7920:Mroh7 UTSW 4 106,564,773 (GRCm39) missense probably benign
R7998:Mroh7 UTSW 4 106,568,478 (GRCm39) missense probably benign 0.02
R8026:Mroh7 UTSW 4 106,578,634 (GRCm39) missense probably benign 0.01
R8122:Mroh7 UTSW 4 106,559,726 (GRCm39) missense probably damaging 0.96
R8249:Mroh7 UTSW 4 106,578,409 (GRCm39) missense probably benign 0.00
R9188:Mroh7 UTSW 4 106,566,789 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGACAGTGTTTATTTGGACAGG -3'
(R):5'- TTACAGGCAGAAGAGTTGCC -3'

Sequencing Primer
(F):5'- TAATGAATGTAGTAGCATGGGGTG -3'
(R):5'- AGAGTTGCCCAAAGCTCTG -3'
Posted On 2019-10-07