Incidental Mutation 'R7419:Mug2'
ID 575522
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission 045497-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R7419 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 121983720-122062924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122017529 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 422 (Y422C)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect possibly damaging
Transcript: ENSMUST00000081777
AA Change: Y422C

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: Y422C

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Meta Mutation Damage Score 0.2900 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,226,959 (GRCm39) S572P probably damaging Het
Abca13 T C 11: 9,247,833 (GRCm39) Y2527H probably damaging Het
Abcc5 A G 16: 20,241,173 (GRCm39) I4T possibly damaging Het
Adamts12 C T 15: 11,317,365 (GRCm39) T1355I probably benign Het
Aloxe3 A G 11: 69,018,353 (GRCm39) T117A probably benign Het
Asb15 A G 6: 24,556,555 (GRCm39) I17V probably benign Het
Atf2 A G 2: 73,672,777 (GRCm39) V194A probably benign Het
Capn7 T C 14: 31,071,779 (GRCm39) V221A probably benign Het
Ccdc107 A T 4: 43,493,512 (GRCm39) S28C probably benign Het
Cct4 C T 11: 22,946,420 (GRCm39) T162I probably benign Het
Cdc40 A T 10: 40,717,439 (GRCm39) H417Q probably damaging Het
Celf1 A G 2: 90,833,588 (GRCm39) I115V probably benign Het
Ces3a A G 8: 105,783,056 (GRCm39) Y395C probably damaging Het
Cfh C A 1: 140,033,204 (GRCm39) C798F probably damaging Het
Clstn3 T C 6: 124,435,088 (GRCm39) T313A probably benign Het
Crmp1 T A 5: 37,436,229 (GRCm39) M329K probably benign Het
Csf2ra C T 19: 61,215,491 (GRCm39) A76T possibly damaging Het
Cspg4 T A 9: 56,795,727 (GRCm39) V1154E possibly damaging Het
Cyp2a4 A T 7: 26,014,188 (GRCm39) N455I probably benign Het
Cyp4a32 T G 4: 115,468,234 (GRCm39) M268R probably benign Het
Dcaf13 T A 15: 38,993,615 (GRCm39) I236N probably damaging Het
Dennd2a A G 6: 39,500,397 (GRCm39) I56T probably damaging Het
Eif2d T A 1: 131,098,793 (GRCm39) S530R probably benign Het
Ep300 T A 15: 81,532,715 (GRCm39) M1651K unknown Het
Epha3 G A 16: 63,418,657 (GRCm39) T596I probably damaging Het
Fam171a2 C T 11: 102,329,628 (GRCm39) C377Y possibly damaging Het
Fat4 T A 3: 39,054,385 (GRCm39) N4142K probably damaging Het
Galnt5 C A 2: 57,904,937 (GRCm39) S500Y probably damaging Het
Gas6 A G 8: 13,521,456 (GRCm39) V431A probably benign Het
Gm7544 C T 1: 82,933,502 (GRCm39) C56Y unknown Het
Golgb1 T A 16: 36,733,281 (GRCm39) L884I possibly damaging Het
Gpatch2l T G 12: 86,312,025 (GRCm39) probably null Het
Gpr33 T C 12: 52,070,050 (GRCm39) T330A probably benign Het
H2bw2 G A X: 135,828,471 (GRCm39) R120K unknown Het
Ifi205 A G 1: 173,855,874 (GRCm39) M52T possibly damaging Het
Ino80 A T 2: 119,210,495 (GRCm39) D1346E probably benign Het
Ino80c T C 18: 24,241,836 (GRCm39) K183R unknown Het
Itgal G T 7: 126,906,047 (GRCm39) R379L probably benign Het
Itih3 T A 14: 30,636,730 (GRCm39) T582S probably benign Het
Kcnb2 T C 1: 15,781,251 (GRCm39) S708P possibly damaging Het
Kcnt1 A T 2: 25,806,011 (GRCm39) Y1200F probably benign Het
L3mbtl4 G A 17: 68,948,537 (GRCm39) D473N probably benign Het
Lama1 T G 17: 68,024,169 (GRCm39) I89R Het
Lama2 A G 10: 27,142,630 (GRCm39) I616T probably benign Het
Lipm A C 19: 34,093,881 (GRCm39) D266A probably benign Het
Lrrc4c A T 2: 97,460,106 (GRCm39) H244L probably benign Het
Lrrtm3 T C 10: 63,923,925 (GRCm39) E414G probably damaging Het
Ltbp4 A G 7: 27,029,192 (GRCm39) V231A unknown Het
Me3 G T 7: 89,385,927 (GRCm39) R92L probably damaging Het
Mroh7 T G 4: 106,541,115 (GRCm39) I1175L probably benign Het
Muc16 A G 9: 18,553,258 (GRCm39) M4345T probably benign Het
N6amt1 T G 16: 87,164,454 (GRCm39) S214A possibly damaging Het
Ogfrl1 G A 1: 23,422,063 (GRCm39) Q24* probably null Het
Or12e14 A T 2: 87,677,406 (GRCm39) T264S probably benign Het
Or1ad6 T A 11: 50,860,152 (GRCm39) Y102* probably null Het
Or2ag2b T C 7: 106,417,551 (GRCm39) L87P possibly damaging Het
Or4f14 G A 2: 111,742,435 (GRCm39) P280L probably damaging Het
Or4k6 A C 14: 50,475,448 (GRCm39) V298G possibly damaging Het
Or4x13 A G 2: 90,231,803 (GRCm39) D266G probably damaging Het
Or6b6 A G 7: 106,571,353 (GRCm39) M66T probably benign Het
Or7g23 A C 9: 19,086,642 (GRCm39) M110R possibly damaging Het
Or8g23 T A 9: 38,971,465 (GRCm39) I166L probably benign Het
Or8k3 C T 2: 86,058,557 (GRCm39) G253R probably damaging Het
Oser1 A T 2: 163,253,364 (GRCm39) D48E probably benign Het
Piwil4 G A 9: 14,613,691 (GRCm39) P867L probably damaging Het
Pla2g6 C T 15: 79,189,898 (GRCm39) probably null Het
Plxna1 A G 6: 89,334,584 (GRCm39) L15P unknown Het
Ppan C T 9: 20,803,140 (GRCm39) T404I probably benign Het
Pros1 C A 16: 62,748,433 (GRCm39) Y635* probably null Het
Rabep2 G A 7: 126,043,342 (GRCm39) R414Q probably benign Het
Rbms3 T A 9: 116,651,894 (GRCm39) E201V probably damaging Het
Robo4 A C 9: 37,314,105 (GRCm39) I119L probably benign Het
S100b A T 10: 76,095,820 (GRCm39) D66V probably damaging Het
Serpina1f A G 12: 103,656,101 (GRCm39) S376P probably damaging Het
Slc24a4 T C 12: 102,193,350 (GRCm39) probably null Het
Slc30a6 T C 17: 74,730,424 (GRCm39) V438A probably benign Het
Sobp A G 10: 42,897,804 (GRCm39) S594P probably benign Het
Tcstv1b A G 13: 120,634,994 (GRCm39) E92G probably damaging Het
Tmem45b T C 9: 31,339,334 (GRCm39) D213G probably benign Het
Topbp1 T A 9: 103,200,543 (GRCm39) D525E probably benign Het
Trim30c G T 7: 104,037,472 (GRCm39) L165I probably benign Het
Unc13b A T 4: 43,174,023 (GRCm39) D1617V unknown Het
Ush1c A G 7: 45,878,679 (GRCm39) L112P probably damaging Het
Vipr1 T A 9: 121,490,539 (GRCm39) I195N probably damaging Het
Vmn2r38 A C 7: 9,078,354 (GRCm39) V676G probably damaging Het
Vmn2r87 A T 10: 130,307,992 (GRCm39) Y749N probably damaging Het
Vps13d A T 4: 144,842,073 (GRCm39) S2615R Het
Whrn A G 4: 63,334,330 (GRCm39) V828A possibly damaging Het
Zbp1 A G 2: 173,050,958 (GRCm39) V304A probably benign Het
Zeb2 A T 2: 44,886,359 (GRCm39) N899K probably benign Het
Zfp148 T C 16: 33,317,511 (GRCm39) S728P possibly damaging Het
Zfp518a T A 19: 40,902,207 (GRCm39) I712N possibly damaging Het
Zfp683 T C 4: 133,786,211 (GRCm39) V446A probably benign Het
Zranb3 A T 1: 127,891,588 (GRCm39) V796D possibly damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122,024,446 (GRCm39) missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122,017,613 (GRCm39) missense probably damaging 0.99
IGL01314:Mug2 APN 6 122,058,238 (GRCm39) missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122,026,587 (GRCm39) splice site probably benign
IGL01477:Mug2 APN 6 122,058,643 (GRCm39) splice site probably benign
IGL01926:Mug2 APN 6 122,013,063 (GRCm39) splice site probably benign
IGL02019:Mug2 APN 6 122,024,394 (GRCm39) missense probably benign 0.02
IGL02305:Mug2 APN 6 122,013,015 (GRCm39) missense probably benign
IGL02310:Mug2 APN 6 122,036,082 (GRCm39) splice site probably benign
IGL02484:Mug2 APN 6 122,049,712 (GRCm39) missense probably damaging 1.00
IGL02516:Mug2 APN 6 122,047,802 (GRCm39) missense probably damaging 1.00
IGL02531:Mug2 APN 6 122,049,730 (GRCm39) missense probably damaging 1.00
IGL02666:Mug2 APN 6 122,058,285 (GRCm39) missense probably damaging 1.00
IGL02936:Mug2 APN 6 122,058,346 (GRCm39) critical splice donor site probably null
R0114:Mug2 UTSW 6 122,017,607 (GRCm39) missense probably damaging 1.00
R0119:Mug2 UTSW 6 122,013,022 (GRCm39) missense probably benign 0.00
R0123:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122,047,970 (GRCm39) splice site probably benign
R0225:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122,058,558 (GRCm39) missense probably damaging 1.00
R0763:Mug2 UTSW 6 122,052,253 (GRCm39) missense probably benign
R0959:Mug2 UTSW 6 122,062,454 (GRCm39) missense probably benign 0.33
R1104:Mug2 UTSW 6 122,036,014 (GRCm39) missense probably benign
R1239:Mug2 UTSW 6 122,058,637 (GRCm39) splice site probably benign
R1318:Mug2 UTSW 6 122,054,361 (GRCm39) missense probably damaging 1.00
R1460:Mug2 UTSW 6 122,017,492 (GRCm39) splice site probably benign
R1706:Mug2 UTSW 6 122,013,191 (GRCm39) splice site probably benign
R1761:Mug2 UTSW 6 122,051,664 (GRCm39) missense probably benign 0.20
R1901:Mug2 UTSW 6 122,048,801 (GRCm39) missense probably benign 0.02
R1913:Mug2 UTSW 6 122,047,829 (GRCm39) missense probably damaging 1.00
R1943:Mug2 UTSW 6 122,056,598 (GRCm39) missense probably benign
R2054:Mug2 UTSW 6 122,054,451 (GRCm39) missense probably damaging 1.00
R2060:Mug2 UTSW 6 122,056,571 (GRCm39) missense probably benign
R2420:Mug2 UTSW 6 122,060,419 (GRCm39) missense probably damaging 1.00
R2432:Mug2 UTSW 6 122,061,335 (GRCm39) missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R2918:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R3423:Mug2 UTSW 6 122,024,465 (GRCm39) splice site probably benign
R3834:Mug2 UTSW 6 122,026,746 (GRCm39) critical splice donor site probably null
R3902:Mug2 UTSW 6 122,052,526 (GRCm39) missense probably damaging 1.00
R3941:Mug2 UTSW 6 122,040,522 (GRCm39) missense probably benign
R4227:Mug2 UTSW 6 122,017,691 (GRCm39) missense probably benign 0.10
R4284:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4287:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4377:Mug2 UTSW 6 122,047,966 (GRCm39) critical splice donor site probably null
R4419:Mug2 UTSW 6 122,056,589 (GRCm39) missense probably damaging 1.00
R4498:Mug2 UTSW 6 122,059,711 (GRCm39) missense probably damaging 0.99
R4566:Mug2 UTSW 6 122,056,597 (GRCm39) missense probably benign 0.00
R4690:Mug2 UTSW 6 122,013,255 (GRCm39) missense probably benign
R4732:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4733:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4741:Mug2 UTSW 6 122,056,572 (GRCm39) missense probably benign
R4888:Mug2 UTSW 6 122,058,154 (GRCm39) missense probably damaging 1.00
R5199:Mug2 UTSW 6 122,017,619 (GRCm39) missense probably benign
R5347:Mug2 UTSW 6 122,058,551 (GRCm39) missense probably damaging 1.00
R5457:Mug2 UTSW 6 122,026,688 (GRCm39) nonsense probably null
R5495:Mug2 UTSW 6 122,056,609 (GRCm39) missense probably damaging 0.96
R5509:Mug2 UTSW 6 122,061,340 (GRCm39) missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122,060,459 (GRCm39) missense probably null 0.98
R6180:Mug2 UTSW 6 122,056,565 (GRCm39) missense probably benign 0.01
R6184:Mug2 UTSW 6 122,014,005 (GRCm39) missense probably benign
R6199:Mug2 UTSW 6 122,024,398 (GRCm39) missense probably benign 0.05
R6262:Mug2 UTSW 6 122,052,214 (GRCm39) missense probably damaging 1.00
R6416:Mug2 UTSW 6 122,059,713 (GRCm39) missense probably damaging 1.00
R6548:Mug2 UTSW 6 122,024,401 (GRCm39) missense probably damaging 1.00
R6703:Mug2 UTSW 6 122,055,653 (GRCm39) missense probably benign 0.25
R7106:Mug2 UTSW 6 122,059,680 (GRCm39) missense probably damaging 1.00
R7131:Mug2 UTSW 6 122,052,206 (GRCm39) missense probably damaging 1.00
R7372:Mug2 UTSW 6 122,060,425 (GRCm39) missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122,024,446 (GRCm39) missense possibly damaging 0.83
R7423:Mug2 UTSW 6 122,056,685 (GRCm39) missense probably benign 0.00
R7581:Mug2 UTSW 6 122,040,670 (GRCm39) missense probably damaging 1.00
R7582:Mug2 UTSW 6 122,056,603 (GRCm39) missense probably damaging 0.99
R7672:Mug2 UTSW 6 122,017,678 (GRCm39) missense probably benign 0.37
R7713:Mug2 UTSW 6 122,055,754 (GRCm39) missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122,058,317 (GRCm39) missense probably damaging 1.00
R7834:Mug2 UTSW 6 122,013,241 (GRCm39) missense probably benign
R7850:Mug2 UTSW 6 122,052,170 (GRCm39) missense probably damaging 1.00
R8029:Mug2 UTSW 6 122,058,504 (GRCm39) critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122,052,567 (GRCm39) missense probably benign 0.01
R8335:Mug2 UTSW 6 122,017,543 (GRCm39) missense probably benign
R8348:Mug2 UTSW 6 122,049,192 (GRCm39) nonsense probably null
R8557:Mug2 UTSW 6 122,040,660 (GRCm39) missense probably damaging 0.99
R8798:Mug2 UTSW 6 122,058,569 (GRCm39) missense probably damaging 1.00
R8823:Mug2 UTSW 6 122,040,648 (GRCm39) missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122,061,328 (GRCm39) missense probably damaging 1.00
R9153:Mug2 UTSW 6 122,017,627 (GRCm39) missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122,054,442 (GRCm39) missense probably benign 0.06
R9186:Mug2 UTSW 6 122,052,248 (GRCm39) missense probably damaging 0.99
R9418:Mug2 UTSW 6 122,017,700 (GRCm39) missense probably benign 0.00
R9464:Mug2 UTSW 6 122,028,690 (GRCm39) missense probably benign 0.01
R9622:Mug2 UTSW 6 122,028,751 (GRCm39) missense probably benign 0.29
Z1177:Mug2 UTSW 6 122,014,080 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAGGGTGTTAGACATCAATCC -3'
(R):5'- CTCACCAGGTAGTAGAAAACGAGC -3'

Sequencing Primer
(F):5'- GGTGTTAGACATCAATCCATCTAATG -3'
(R):5'- CCAGGTAGTAGAAAACGAGCTCTTTC -3'
Posted On 2019-10-07