Incidental Mutation 'R7419:Muc16'
ID575537
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R7419 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18641962 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 4345 (M4345T)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: M4345T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,276,959 S572P probably damaging Het
Abca13 T C 11: 9,297,833 Y2527H probably damaging Het
Abcc5 A G 16: 20,422,423 I4T possibly damaging Het
Adamts12 C T 15: 11,317,279 T1355I probably benign Het
Aloxe3 A G 11: 69,127,527 T117A probably benign Het
Asb15 A G 6: 24,556,556 I17V probably benign Het
Atf2 A G 2: 73,842,433 V194A probably benign Het
Capn7 T C 14: 31,349,822 V221A probably benign Het
Ccdc107 A T 4: 43,493,512 S28C probably benign Het
Cct4 C T 11: 22,996,420 T162I probably benign Het
Cdc40 A T 10: 40,841,443 H417Q probably damaging Het
Celf1 A G 2: 91,003,243 I115V probably benign Het
Ces3a A G 8: 105,056,424 Y395C probably damaging Het
Cfh C A 1: 140,105,466 C798F probably damaging Het
Clstn3 T C 6: 124,458,129 T313A probably benign Het
Crmp1 T A 5: 37,278,885 M329K probably benign Het
Csf2ra C T 19: 61,227,053 A76T possibly damaging Het
Cspg4 T A 9: 56,888,443 V1154E possibly damaging Het
Cyp2a4 A T 7: 26,314,763 N455I probably benign Het
Cyp4a32 T G 4: 115,611,037 M268R probably benign Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dennd2a A G 6: 39,523,463 I56T probably damaging Het
Eif2d T A 1: 131,171,056 S530R probably benign Het
Ep300 T A 15: 81,648,514 M1651K unknown Het
Epha3 G A 16: 63,598,294 T596I probably damaging Het
Fam171a2 C T 11: 102,438,802 C377Y possibly damaging Het
Fat4 T A 3: 39,000,236 N4142K probably damaging Het
Galnt5 C A 2: 58,014,925 S500Y probably damaging Het
Gas6 A G 8: 13,471,456 V431A probably benign Het
Gm21818 A G 13: 120,173,458 E92G probably damaging Het
Gm7544 C T 1: 82,955,781 C56Y unknown Het
Golgb1 T A 16: 36,912,919 L884I possibly damaging Het
Gpatch2l T G 12: 86,265,251 probably null Het
Gpr33 T C 12: 52,023,267 T330A probably benign Het
H2bfm G A X: 136,927,722 R120K unknown Het
Ifi205 A G 1: 174,028,308 M52T possibly damaging Het
Ino80 A T 2: 119,380,014 D1346E probably benign Het
Ino80c T C 18: 24,108,779 K183R unknown Het
Itgal G T 7: 127,306,875 R379L probably benign Het
Itih3 T A 14: 30,914,773 T582S probably benign Het
Kcnb2 T C 1: 15,711,027 S708P possibly damaging Het
Kcnt1 A T 2: 25,915,999 Y1200F probably benign Het
L3mbtl4 G A 17: 68,641,542 D473N probably benign Het
Lama1 T G 17: 67,717,174 I89R Het
Lama2 A G 10: 27,266,634 I616T probably benign Het
Lipm A C 19: 34,116,481 D266A probably benign Het
Lrrc4c A T 2: 97,629,761 H244L probably benign Het
Lrrtm3 T C 10: 64,088,146 E414G probably damaging Het
Ltbp4 A G 7: 27,329,767 V231A unknown Het
Me3 G T 7: 89,736,719 R92L probably damaging Het
Mroh7 T G 4: 106,683,918 I1175L probably benign Het
Mug2 A G 6: 122,040,570 Y422C possibly damaging Het
N6amt1 T G 16: 87,367,566 S214A possibly damaging Het
Ogfrl1 G A 1: 23,382,982 Q24* probably null Het
Olfr1047 C T 2: 86,228,213 G253R probably damaging Het
Olfr1150-ps1 A T 2: 87,847,062 T264S probably benign Het
Olfr1274-ps A G 2: 90,401,459 D266G probably damaging Het
Olfr1306 G A 2: 111,912,090 P280L probably damaging Het
Olfr1378 T A 11: 50,969,325 Y102* probably null Het
Olfr701 T C 7: 106,818,344 L87P possibly damaging Het
Olfr711 A G 7: 106,972,146 M66T probably benign Het
Olfr731 A C 14: 50,237,991 V298G possibly damaging Het
Olfr839-ps1 A C 9: 19,175,346 M110R possibly damaging Het
Olfr937 T A 9: 39,060,169 I166L probably benign Het
Oser1 A T 2: 163,411,444 D48E probably benign Het
Piwil4 G A 9: 14,702,395 P867L probably damaging Het
Plxna1 A G 6: 89,357,602 L15P unknown Het
Ppan C T 9: 20,891,844 T404I probably benign Het
Pros1 C A 16: 62,928,070 Y635* probably null Het
Rabep2 G A 7: 126,444,170 R414Q probably benign Het
Rbms3 T A 9: 116,822,826 E201V probably damaging Het
Robo4 A C 9: 37,402,809 I119L probably benign Het
S100b A T 10: 76,259,986 D66V probably damaging Het
Serpina1f A G 12: 103,689,842 S376P probably damaging Het
Slc24a4 T C 12: 102,227,091 probably null Het
Slc30a6 T C 17: 74,423,429 V438A probably benign Het
Sobp A G 10: 43,021,808 S594P probably benign Het
Tmem45b T C 9: 31,428,038 D213G probably benign Het
Topbp1 T A 9: 103,323,344 D525E probably benign Het
Trim30c G T 7: 104,388,265 L165I probably benign Het
Unc13b A T 4: 43,174,023 D1617V unknown Het
Ush1c A G 7: 46,229,255 L112P probably damaging Het
Vipr1 T A 9: 121,661,473 I195N probably damaging Het
Vmn2r38 A C 7: 9,075,355 V676G probably damaging Het
Vmn2r87 A T 10: 130,472,123 Y749N probably damaging Het
Vps13d A T 4: 145,115,503 S2615R Het
Whrn A G 4: 63,416,093 V828A possibly damaging Het
Zbp1 A G 2: 173,209,165 V304A probably benign Het
Zeb2 A T 2: 44,996,347 N899K probably benign Het
Zfp148 T C 16: 33,497,141 S728P possibly damaging Het
Zfp518a T A 19: 40,913,763 I712N possibly damaging Het
Zfp683 T C 4: 134,058,900 V446A probably benign Het
Zranb3 A T 1: 127,963,851 V796D possibly damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
Predicted Primers PCR Primer
(F):5'- TATCGTCTCTGGAGCACTAGTTG -3'
(R):5'- TCAAGCAGAAACTAATGGGACC -3'

Sequencing Primer
(F):5'- CTCTGGAGCACTAGTTGAGATTAATG -3'
(R):5'- TGGGACCATTACACCATGGAAC -3'
Posted On2019-10-07