Incidental Mutation 'R7419:Aloxe3'
ID575557
Institutional Source Beutler Lab
Gene Symbol Aloxe3
Ensembl Gene ENSMUSG00000020892
Gene Namearachidonate lipoxygenase 3
Synonymse-LOX-3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7419 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69125896-69149115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69127527 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 117 (T117A)
Ref Sequence ENSEMBL: ENSMUSP00000021268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021268] [ENSMUST00000024543] [ENSMUST00000175661] [ENSMUST00000180487]
Predicted Effect probably benign
Transcript: ENSMUST00000021268
AA Change: T117A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021268
Gene: ENSMUSG00000020892
AA Change: T117A

DomainStartEndE-ValueType
LH2 2 116 1.93e-20 SMART
Pfam:Lipoxygenase 249 697 3.4e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024543
SMART Domains Protein: ENSMUSP00000024543
Gene: ENSMUSG00000023781

DomainStartEndE-ValueType
HLH 18 75 2.01e-5 SMART
low complexity region 137 152 N/A INTRINSIC
low complexity region 188 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175661
AA Change: T117A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134814
Gene: ENSMUSG00000020892
AA Change: T117A

DomainStartEndE-ValueType
LH2 2 116 1.93e-20 SMART
Pfam:Lipoxygenase 245 377 7.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180487
SMART Domains Protein: ENSMUSP00000137894
Gene: ENSMUSG00000097386

DomainStartEndE-ValueType
low complexity region 31 40 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoxygenase family, which are catabolized by arachidonic acid-derived compounds. The encoded enzyme is a hydroperoxide isomerase that synthesizes a unique type of epoxy alcohol (8R-hydroxy-11R,12R-epoxyeicosa-5Z,9E,14Z-trienoic acid) from 12R-hydroperoxyeicosatetraenoic acid (12R-HPETE). This epoxy alcohol can activate the the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha), which is implicated in epidermal differentiation. Loss of function of the enzyme encoded by this gene results in ichthyosis, implicating the function of this gene in the differentiation of human skin. This gene is part of a cluster of lipoxygenase genes on 17p13.1. Mutations in this gene result in nonbullous congenital ichthyosiform erythroderma (NCIE). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality, imapired skin barrier function, dehydration, tightly packed stratum corneum, impaired stratum corneum desquamation and reduced levels of ester-bound ceramide in the epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,276,959 S572P probably damaging Het
Abca13 T C 11: 9,297,833 Y2527H probably damaging Het
Abcc5 A G 16: 20,422,423 I4T possibly damaging Het
Adamts12 C T 15: 11,317,279 T1355I probably benign Het
Asb15 A G 6: 24,556,556 I17V probably benign Het
Atf2 A G 2: 73,842,433 V194A probably benign Het
Capn7 T C 14: 31,349,822 V221A probably benign Het
Ccdc107 A T 4: 43,493,512 S28C probably benign Het
Cct4 C T 11: 22,996,420 T162I probably benign Het
Cdc40 A T 10: 40,841,443 H417Q probably damaging Het
Celf1 A G 2: 91,003,243 I115V probably benign Het
Ces3a A G 8: 105,056,424 Y395C probably damaging Het
Cfh C A 1: 140,105,466 C798F probably damaging Het
Clstn3 T C 6: 124,458,129 T313A probably benign Het
Crmp1 T A 5: 37,278,885 M329K probably benign Het
Csf2ra C T 19: 61,227,053 A76T possibly damaging Het
Cspg4 T A 9: 56,888,443 V1154E possibly damaging Het
Cyp2a4 A T 7: 26,314,763 N455I probably benign Het
Cyp4a32 T G 4: 115,611,037 M268R probably benign Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dennd2a A G 6: 39,523,463 I56T probably damaging Het
Eif2d T A 1: 131,171,056 S530R probably benign Het
Ep300 T A 15: 81,648,514 M1651K unknown Het
Epha3 G A 16: 63,598,294 T596I probably damaging Het
Fam171a2 C T 11: 102,438,802 C377Y possibly damaging Het
Fat4 T A 3: 39,000,236 N4142K probably damaging Het
Galnt5 C A 2: 58,014,925 S500Y probably damaging Het
Gas6 A G 8: 13,471,456 V431A probably benign Het
Gm21818 A G 13: 120,173,458 E92G probably damaging Het
Gm7544 C T 1: 82,955,781 C56Y unknown Het
Golgb1 T A 16: 36,912,919 L884I possibly damaging Het
Gpatch2l T G 12: 86,265,251 probably null Het
Gpr33 T C 12: 52,023,267 T330A probably benign Het
H2bfm G A X: 136,927,722 R120K unknown Het
Ifi205 A G 1: 174,028,308 M52T possibly damaging Het
Ino80 A T 2: 119,380,014 D1346E probably benign Het
Ino80c T C 18: 24,108,779 K183R unknown Het
Itgal G T 7: 127,306,875 R379L probably benign Het
Itih3 T A 14: 30,914,773 T582S probably benign Het
Kcnb2 T C 1: 15,711,027 S708P possibly damaging Het
Kcnt1 A T 2: 25,915,999 Y1200F probably benign Het
L3mbtl4 G A 17: 68,641,542 D473N probably benign Het
Lama1 T G 17: 67,717,174 I89R Het
Lama2 A G 10: 27,266,634 I616T probably benign Het
Lipm A C 19: 34,116,481 D266A probably benign Het
Lrrc4c A T 2: 97,629,761 H244L probably benign Het
Lrrtm3 T C 10: 64,088,146 E414G probably damaging Het
Ltbp4 A G 7: 27,329,767 V231A unknown Het
Me3 G T 7: 89,736,719 R92L probably damaging Het
Mroh7 T G 4: 106,683,918 I1175L probably benign Het
Muc16 A G 9: 18,641,962 M4345T probably benign Het
Mug2 A G 6: 122,040,570 Y422C possibly damaging Het
N6amt1 T G 16: 87,367,566 S214A possibly damaging Het
Ogfrl1 G A 1: 23,382,982 Q24* probably null Het
Olfr1047 C T 2: 86,228,213 G253R probably damaging Het
Olfr1150-ps1 A T 2: 87,847,062 T264S probably benign Het
Olfr1274-ps A G 2: 90,401,459 D266G probably damaging Het
Olfr1306 G A 2: 111,912,090 P280L probably damaging Het
Olfr1378 T A 11: 50,969,325 Y102* probably null Het
Olfr701 T C 7: 106,818,344 L87P possibly damaging Het
Olfr711 A G 7: 106,972,146 M66T probably benign Het
Olfr731 A C 14: 50,237,991 V298G possibly damaging Het
Olfr839-ps1 A C 9: 19,175,346 M110R possibly damaging Het
Olfr937 T A 9: 39,060,169 I166L probably benign Het
Oser1 A T 2: 163,411,444 D48E probably benign Het
Piwil4 G A 9: 14,702,395 P867L probably damaging Het
Plxna1 A G 6: 89,357,602 L15P unknown Het
Ppan C T 9: 20,891,844 T404I probably benign Het
Pros1 C A 16: 62,928,070 Y635* probably null Het
Rabep2 G A 7: 126,444,170 R414Q probably benign Het
Rbms3 T A 9: 116,822,826 E201V probably damaging Het
Robo4 A C 9: 37,402,809 I119L probably benign Het
S100b A T 10: 76,259,986 D66V probably damaging Het
Serpina1f A G 12: 103,689,842 S376P probably damaging Het
Slc24a4 T C 12: 102,227,091 probably null Het
Slc30a6 T C 17: 74,423,429 V438A probably benign Het
Sobp A G 10: 43,021,808 S594P probably benign Het
Tmem45b T C 9: 31,428,038 D213G probably benign Het
Topbp1 T A 9: 103,323,344 D525E probably benign Het
Trim30c G T 7: 104,388,265 L165I probably benign Het
Unc13b A T 4: 43,174,023 D1617V unknown Het
Ush1c A G 7: 46,229,255 L112P probably damaging Het
Vipr1 T A 9: 121,661,473 I195N probably damaging Het
Vmn2r38 A C 7: 9,075,355 V676G probably damaging Het
Vmn2r87 A T 10: 130,472,123 Y749N probably damaging Het
Vps13d A T 4: 145,115,503 S2615R Het
Whrn A G 4: 63,416,093 V828A possibly damaging Het
Zbp1 A G 2: 173,209,165 V304A probably benign Het
Zeb2 A T 2: 44,996,347 N899K probably benign Het
Zfp148 T C 16: 33,497,141 S728P possibly damaging Het
Zfp518a T A 19: 40,913,763 I712N possibly damaging Het
Zfp683 T C 4: 134,058,900 V446A probably benign Het
Zranb3 A T 1: 127,963,851 V796D possibly damaging Het
Other mutations in Aloxe3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Aloxe3 APN 11 69130013 missense probably benign 0.41
IGL01925:Aloxe3 APN 11 69128633 missense probably damaging 1.00
IGL01947:Aloxe3 APN 11 69143021 splice site probably benign
IGL02421:Aloxe3 APN 11 69130046 missense possibly damaging 0.87
IGL03206:Aloxe3 APN 11 69129646 missense possibly damaging 0.74
IGL03054:Aloxe3 UTSW 11 69129607 missense possibly damaging 0.78
R1613:Aloxe3 UTSW 11 69130046 missense possibly damaging 0.87
R1757:Aloxe3 UTSW 11 69135949 missense possibly damaging 0.72
R1839:Aloxe3 UTSW 11 69130085 missense probably damaging 1.00
R2182:Aloxe3 UTSW 11 69129600 missense possibly damaging 0.93
R2912:Aloxe3 UTSW 11 69130040 missense probably damaging 1.00
R2919:Aloxe3 UTSW 11 69142923 missense probably damaging 0.99
R2920:Aloxe3 UTSW 11 69142923 missense probably damaging 0.99
R4731:Aloxe3 UTSW 11 69128654 missense probably null 0.59
R5245:Aloxe3 UTSW 11 69129676 missense probably benign 0.00
R5459:Aloxe3 UTSW 11 69132828 missense possibly damaging 0.66
R5493:Aloxe3 UTSW 11 69128617 nonsense probably null
R5725:Aloxe3 UTSW 11 69128654 missense probably null 0.59
R5755:Aloxe3 UTSW 11 69132749 missense probably benign 0.04
R5789:Aloxe3 UTSW 11 69126439 missense probably damaging 1.00
R7343:Aloxe3 UTSW 11 69132743 missense probably benign 0.00
R7451:Aloxe3 UTSW 11 69142920 missense possibly damaging 0.90
R7669:Aloxe3 UTSW 11 69135120 missense probably benign 0.00
X0019:Aloxe3 UTSW 11 69148735 missense probably damaging 1.00
X0020:Aloxe3 UTSW 11 69133027 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTTGCTCAAAGGCCTGCTTG -3'
(R):5'- CTCTTGCATGTCAGGACTTTAGC -3'

Sequencing Primer
(F):5'- CTCACTCCAGGTTCAGAAGTATAAGG -3'
(R):5'- CATGTCAGGACTTTAGCAGTGC -3'
Posted On2019-10-07