Incidental Mutation 'R7419:Ep300'
ID575569
Institutional Source Beutler Lab
Gene Symbol Ep300
Ensembl Gene ENSMUSG00000055024
Gene NameE1A binding protein p300
SynonymsKAT3B, p300
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7419 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location81585351-81652077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81648514 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1651 (M1651K)
Ref Sequence ENSEMBL: ENSMUSP00000066789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068387]
Predicted Effect unknown
Transcript: ENSMUST00000068387
AA Change: M1651K
SMART Domains Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: M1651K

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 296 309 N/A INTRINSIC
ZnF_TAZ 333 418 2.85e-32 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
Pfam:KIX 567 647 7.2e-44 PFAM
low complexity region 722 735 N/A INTRINSIC
low complexity region 831 848 N/A INTRINSIC
low complexity region 852 882 N/A INTRINSIC
low complexity region 884 920 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 1024 1039 N/A INTRINSIC
BROMO 1047 1157 6.36e-42 SMART
Blast:KAT11 1227 1300 9e-22 BLAST
KAT11 1305 1610 1.19e-140 SMART
ZnF_ZZ 1663 1704 2.67e-15 SMART
ZnF_TAZ 1728 1806 5.53e-30 SMART
low complexity region 1810 1836 N/A INTRINSIC
low complexity region 1847 1881 N/A INTRINSIC
low complexity region 1902 1927 N/A INTRINSIC
low complexity region 1962 1979 N/A INTRINSIC
Pfam:Creb_binding 1993 2099 3.5e-37 PFAM
low complexity region 2146 2158 N/A INTRINSIC
low complexity region 2187 2203 N/A INTRINSIC
low complexity region 2205 2244 N/A INTRINSIC
low complexity region 2254 2265 N/A INTRINSIC
low complexity region 2303 2346 N/A INTRINSIC
low complexity region 2390 2405 N/A INTRINSIC
Meta Mutation Damage Score 0.8236 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,276,959 S572P probably damaging Het
Abca13 T C 11: 9,297,833 Y2527H probably damaging Het
Abcc5 A G 16: 20,422,423 I4T possibly damaging Het
Adamts12 C T 15: 11,317,279 T1355I probably benign Het
Aloxe3 A G 11: 69,127,527 T117A probably benign Het
Asb15 A G 6: 24,556,556 I17V probably benign Het
Atf2 A G 2: 73,842,433 V194A probably benign Het
Capn7 T C 14: 31,349,822 V221A probably benign Het
Ccdc107 A T 4: 43,493,512 S28C probably benign Het
Cct4 C T 11: 22,996,420 T162I probably benign Het
Cdc40 A T 10: 40,841,443 H417Q probably damaging Het
Celf1 A G 2: 91,003,243 I115V probably benign Het
Ces3a A G 8: 105,056,424 Y395C probably damaging Het
Cfh C A 1: 140,105,466 C798F probably damaging Het
Clstn3 T C 6: 124,458,129 T313A probably benign Het
Crmp1 T A 5: 37,278,885 M329K probably benign Het
Csf2ra C T 19: 61,227,053 A76T possibly damaging Het
Cspg4 T A 9: 56,888,443 V1154E possibly damaging Het
Cyp2a4 A T 7: 26,314,763 N455I probably benign Het
Cyp4a32 T G 4: 115,611,037 M268R probably benign Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dennd2a A G 6: 39,523,463 I56T probably damaging Het
Eif2d T A 1: 131,171,056 S530R probably benign Het
Epha3 G A 16: 63,598,294 T596I probably damaging Het
Fam171a2 C T 11: 102,438,802 C377Y possibly damaging Het
Fat4 T A 3: 39,000,236 N4142K probably damaging Het
Galnt5 C A 2: 58,014,925 S500Y probably damaging Het
Gas6 A G 8: 13,471,456 V431A probably benign Het
Gm21818 A G 13: 120,173,458 E92G probably damaging Het
Gm7544 C T 1: 82,955,781 C56Y unknown Het
Golgb1 T A 16: 36,912,919 L884I possibly damaging Het
Gpatch2l T G 12: 86,265,251 probably null Het
Gpr33 T C 12: 52,023,267 T330A probably benign Het
H2bfm G A X: 136,927,722 R120K unknown Het
Ifi205 A G 1: 174,028,308 M52T possibly damaging Het
Ino80 A T 2: 119,380,014 D1346E probably benign Het
Ino80c T C 18: 24,108,779 K183R unknown Het
Itgal G T 7: 127,306,875 R379L probably benign Het
Itih3 T A 14: 30,914,773 T582S probably benign Het
Kcnb2 T C 1: 15,711,027 S708P possibly damaging Het
Kcnt1 A T 2: 25,915,999 Y1200F probably benign Het
L3mbtl4 G A 17: 68,641,542 D473N probably benign Het
Lama1 T G 17: 67,717,174 I89R Het
Lama2 A G 10: 27,266,634 I616T probably benign Het
Lipm A C 19: 34,116,481 D266A probably benign Het
Lrrc4c A T 2: 97,629,761 H244L probably benign Het
Lrrtm3 T C 10: 64,088,146 E414G probably damaging Het
Ltbp4 A G 7: 27,329,767 V231A unknown Het
Me3 G T 7: 89,736,719 R92L probably damaging Het
Mroh7 T G 4: 106,683,918 I1175L probably benign Het
Muc16 A G 9: 18,641,962 M4345T probably benign Het
Mug2 A G 6: 122,040,570 Y422C possibly damaging Het
N6amt1 T G 16: 87,367,566 S214A possibly damaging Het
Ogfrl1 G A 1: 23,382,982 Q24* probably null Het
Olfr1047 C T 2: 86,228,213 G253R probably damaging Het
Olfr1150-ps1 A T 2: 87,847,062 T264S probably benign Het
Olfr1274-ps A G 2: 90,401,459 D266G probably damaging Het
Olfr1306 G A 2: 111,912,090 P280L probably damaging Het
Olfr1378 T A 11: 50,969,325 Y102* probably null Het
Olfr701 T C 7: 106,818,344 L87P possibly damaging Het
Olfr711 A G 7: 106,972,146 M66T probably benign Het
Olfr731 A C 14: 50,237,991 V298G possibly damaging Het
Olfr839-ps1 A C 9: 19,175,346 M110R possibly damaging Het
Olfr937 T A 9: 39,060,169 I166L probably benign Het
Oser1 A T 2: 163,411,444 D48E probably benign Het
Piwil4 G A 9: 14,702,395 P867L probably damaging Het
Pla2g6 C T 15: 79,305,698 probably null Het
Plxna1 A G 6: 89,357,602 L15P unknown Het
Ppan C T 9: 20,891,844 T404I probably benign Het
Pros1 C A 16: 62,928,070 Y635* probably null Het
Rabep2 G A 7: 126,444,170 R414Q probably benign Het
Rbms3 T A 9: 116,822,826 E201V probably damaging Het
Robo4 A C 9: 37,402,809 I119L probably benign Het
S100b A T 10: 76,259,986 D66V probably damaging Het
Serpina1f A G 12: 103,689,842 S376P probably damaging Het
Slc24a4 T C 12: 102,227,091 probably null Het
Slc30a6 T C 17: 74,423,429 V438A probably benign Het
Sobp A G 10: 43,021,808 S594P probably benign Het
Tmem45b T C 9: 31,428,038 D213G probably benign Het
Topbp1 T A 9: 103,323,344 D525E probably benign Het
Trim30c G T 7: 104,388,265 L165I probably benign Het
Unc13b A T 4: 43,174,023 D1617V unknown Het
Ush1c A G 7: 46,229,255 L112P probably damaging Het
Vipr1 T A 9: 121,661,473 I195N probably damaging Het
Vmn2r38 A C 7: 9,075,355 V676G probably damaging Het
Vmn2r87 A T 10: 130,472,123 Y749N probably damaging Het
Vps13d A T 4: 145,115,503 S2615R Het
Whrn A G 4: 63,416,093 V828A possibly damaging Het
Zbp1 A G 2: 173,209,165 V304A probably benign Het
Zeb2 A T 2: 44,996,347 N899K probably benign Het
Zfp148 T C 16: 33,497,141 S728P possibly damaging Het
Zfp518a T A 19: 40,913,763 I712N possibly damaging Het
Zfp683 T C 4: 134,058,900 V446A probably benign Het
Zranb3 A T 1: 127,963,851 V796D possibly damaging Het
Other mutations in Ep300
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ep300 APN 15 81641418 missense unknown
IGL01128:Ep300 APN 15 81630006 unclassified probably benign
IGL01151:Ep300 APN 15 81623472 intron probably benign
IGL01414:Ep300 APN 15 81627266 unclassified probably benign
IGL01564:Ep300 APN 15 81632464 unclassified probably benign
IGL01875:Ep300 APN 15 81640023 missense unknown
IGL01945:Ep300 APN 15 81616109 unclassified probably benign
IGL02022:Ep300 APN 15 81611437 unclassified probably benign
IGL02115:Ep300 APN 15 81648818 missense unknown
IGL02129:Ep300 APN 15 81586636 missense unknown
IGL02145:Ep300 APN 15 81601166 missense unknown
IGL02149:Ep300 APN 15 81628420 unclassified probably benign
IGL02165:Ep300 APN 15 81641391 missense probably benign 0.39
IGL02226:Ep300 APN 15 81613412 missense unknown
IGL02610:Ep300 APN 15 81601522 missense unknown
IGL02731:Ep300 APN 15 81648414 missense unknown
IGL03239:Ep300 APN 15 81641388 missense unknown
R0077:Ep300 UTSW 15 81641313 missense unknown
R0145:Ep300 UTSW 15 81616127 critical splice donor site probably null
R0244:Ep300 UTSW 15 81640128 missense unknown
R0390:Ep300 UTSW 15 81640116 missense unknown
R0534:Ep300 UTSW 15 81600896 splice site probably benign
R0671:Ep300 UTSW 15 81616134 unclassified probably benign
R0840:Ep300 UTSW 15 81644933 missense unknown
R1166:Ep300 UTSW 15 81630064 unclassified probably benign
R1737:Ep300 UTSW 15 81626347 missense probably damaging 0.99
R1893:Ep300 UTSW 15 81631646 unclassified probably benign
R2136:Ep300 UTSW 15 81640447 missense unknown
R3427:Ep300 UTSW 15 81601279 missense unknown
R3757:Ep300 UTSW 15 81648589 missense unknown
R3892:Ep300 UTSW 15 81619997 unclassified probably benign
R4554:Ep300 UTSW 15 81601430 missense unknown
R4575:Ep300 UTSW 15 81649009 missense unknown
R4575:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81611410 unclassified probably benign
R5021:Ep300 UTSW 15 81640023 missense unknown
R5366:Ep300 UTSW 15 81616100 missense probably benign 0.24
R5372:Ep300 UTSW 15 81636830 missense unknown
R5393:Ep300 UTSW 15 81631618 unclassified probably benign
R5410:Ep300 UTSW 15 81648854 missense unknown
R5571:Ep300 UTSW 15 81643217 intron probably benign
R5701:Ep300 UTSW 15 81601495 missense unknown
R5772:Ep300 UTSW 15 81639914 intron probably benign
R5825:Ep300 UTSW 15 81611472 missense probably benign 0.39
R5917:Ep300 UTSW 15 81628607 unclassified probably benign
R5991:Ep300 UTSW 15 81648466 missense unknown
R6019:Ep300 UTSW 15 81641382 missense unknown
R6144:Ep300 UTSW 15 81601234 missense unknown
R6291:Ep300 UTSW 15 81648507 missense unknown
R6292:Ep300 UTSW 15 81616734 unclassified probably benign
R6599:Ep300 UTSW 15 81586713 missense unknown
R6804:Ep300 UTSW 15 81641311 nonsense probably null
R6925:Ep300 UTSW 15 81649981 missense probably benign 0.32
R7327:Ep300 UTSW 15 81627314 missense unknown
R7378:Ep300 UTSW 15 81650545 missense probably damaging 0.97
R7388:Ep300 UTSW 15 81648366 missense unknown
R7498:Ep300 UTSW 15 81639843 missense unknown
R7584:Ep300 UTSW 15 81628426 missense unknown
R7605:Ep300 UTSW 15 81621152 missense unknown
R7619:Ep300 UTSW 15 81608198 missense unknown
R7763:Ep300 UTSW 15 81586583 start gained probably benign
R7775:Ep300 UTSW 15 81586686 missense unknown
R7778:Ep300 UTSW 15 81586686 missense unknown
R7862:Ep300 UTSW 15 81650753 missense probably damaging 1.00
R7945:Ep300 UTSW 15 81650753 missense probably damaging 1.00
R8155:Ep300 UTSW 15 81621068 missense unknown
RF020:Ep300 UTSW 15 81586571 start gained probably benign
Z1177:Ep300 UTSW 15 81630097 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGTGGCATTGCAGTTCGAAAG -3'
(R):5'- GGGCAGAGGTTTGTAACACATG -3'

Sequencing Primer
(F):5'- GCATTGCAGTTCGAAAGTCACAATG -3'
(R):5'- GGCAGAGGTTTGTAACACATGTTTAC -3'
Posted On2019-10-07