Incidental Mutation 'R7420:Fam135a'
ID575584
Institutional Source Beutler Lab
Gene Symbol Fam135a
Ensembl Gene ENSMUSG00000026153
Gene Namefamily with sequence similarity 135, member A
Synonyms4921533L14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R7420 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location24011093-24100341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24012486 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1443 (S1443P)
Ref Sequence ENSEMBL: ENSMUSP00000027337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027337] [ENSMUST00000186331] [ENSMUST00000187369] [ENSMUST00000187752] [ENSMUST00000188712]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027337
AA Change: S1443P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027337
Gene: ENSMUSG00000026153
AA Change: S1443P

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
coiled coil region 270 295 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 1072 1085 N/A INTRINSIC
Blast:LRRNT 1139 1172 4e-6 BLAST
low complexity region 1173 1184 N/A INTRINSIC
Pfam:DUF676 1235 1431 9e-65 PFAM
Pfam:PGAP1 1237 1440 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186331
SMART Domains Protein: ENSMUSP00000140947
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
low complexity region 172 185 N/A INTRINSIC
Blast:LRRNT 239 272 1e-6 BLAST
low complexity region 273 284 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187369
AA Change: S1247P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140766
Gene: ENSMUSG00000026153
AA Change: S1247P

DomainStartEndE-ValueType
Pfam:DUF3657 111 173 3e-15 PFAM
coiled coil region 270 295 N/A INTRINSIC
Pfam:DUF3657 312 369 1.2e-7 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Blast:LRRNT 943 976 4e-6 BLAST
low complexity region 977 988 N/A INTRINSIC
Pfam:DUF676 1039 1235 6.8e-62 PFAM
Pfam:PGAP1 1041 1259 8.1e-5 PFAM
Pfam:LCAT 1097 1203 2.3e-4 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000187752
AA Change: S1230P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139633
Gene: ENSMUSG00000026153
AA Change: S1230P

DomainStartEndE-ValueType
Pfam:DUF3657 68 130 3e-15 PFAM
Pfam:DUF3657 295 352 1.2e-7 PFAM
low complexity region 629 640 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Blast:LRRNT 926 959 4e-6 BLAST
low complexity region 960 971 N/A INTRINSIC
Pfam:DUF676 1022 1218 6.7e-62 PFAM
Pfam:PGAP1 1024 1242 8e-5 PFAM
Pfam:LCAT 1080 1186 2.2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188712
Meta Mutation Damage Score 0.0992 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 C T 13: 64,297,317 G164D possibly damaging Het
Abca6 A G 11: 110,250,477 V6A probably benign Het
Adam29 T A 8: 55,872,898 M174L probably benign Het
Ano1 G A 7: 144,655,641 T274I probably benign Het
Atad5 A T 11: 80,095,862 T592S probably benign Het
Bud13 C T 9: 46,287,815 P158L probably benign Het
Card19 T C 13: 49,208,137 Y6C probably damaging Het
Cd36 C G 5: 17,788,274 V393L probably benign Het
Cd79a A T 7: 24,897,546 R9* probably null Het
Cep164 T C 9: 45,768,542 H1131R probably benign Het
Chia1 T A 3: 106,130,664 S321T probably benign Het
Chrnd T A 1: 87,194,821 V217E possibly damaging Het
Cmtm7 T C 9: 114,763,394 probably null Het
Csn1s2a T C 5: 87,780,006 S60P possibly damaging Het
Defa30 T A 8: 21,135,455 N78K probably benign Het
Dnah2 C T 11: 69,478,797 A1618T possibly damaging Het
Dnah9 A G 11: 66,117,407 probably null Het
Epn1 A T 7: 5,097,688 T546S possibly damaging Het
Fam13b G T 18: 34,494,611 P179Q probably damaging Het
Git2 T C 5: 114,730,370 T647A probably benign Het
Gli2 T C 1: 118,835,939 N1494S probably benign Het
Gm4952 G A 19: 12,626,901 G226R probably damaging Het
Gm5460 T A 14: 34,036,757 F156I probably damaging Het
Gm884 A T 11: 103,613,625 S2506T probably benign Het
Heatr5b A T 17: 78,808,480 V849D probably damaging Het
Hepacam A G 9: 37,380,709 D111G probably benign Het
Hk1 T C 10: 62,269,982 D895G probably damaging Het
Kdm5b T C 1: 134,604,497 V471A probably benign Het
Klhdc8b A G 9: 108,449,118 Y239H possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt82 T C 15: 101,545,587 T229A probably damaging Het
Lztr1 T C 16: 17,524,129 L656P probably damaging Het
Mfrp T C 9: 44,102,476 probably benign Het
Mrvi1 A T 7: 110,871,473 Y678* probably null Het
Nfe2l1 A G 11: 96,819,913 S497P probably benign Het
Olfr694 G A 7: 106,689,020 A237V possibly damaging Het
Olfr907 G T 9: 38,499,063 L131F probably benign Het
Otud4 C A 8: 79,664,108 T418K probably benign Het
Pcdhb21 A G 18: 37,515,203 N462D probably damaging Het
Plch1 A G 3: 63,722,857 S497P probably damaging Het
Plekha8 T C 6: 54,613,194 V48A probably damaging Het
Ppp2r5d A T 17: 46,687,581 F121L probably null Het
Sdad1 G A 5: 92,305,737 A64V possibly damaging Het
Selenop G T 15: 3,279,570 A335S probably damaging Het
Shc3 T C 13: 51,431,235 N448S probably benign Het
Shcbp1 G A 8: 4,748,737 T394I probably benign Het
Slc39a11 G T 11: 113,247,822 A276E probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Speg T A 1: 75,430,905 S3185R probably damaging Het
Tmem100 A T 11: 90,035,753 *135Y probably null Het
Ube2o A T 11: 116,540,072 F1001I probably damaging Het
Usp7 T C 16: 8,710,121 D148G probably benign Het
Vmn2r16 A G 5: 109,363,870 T648A probably damaging Het
Vmn2r67 A G 7: 85,136,736 L687P possibly damaging Het
Zcchc14 ACCGCCGCCGCCGCCGCC ACCGCCGCCGCCGCC 8: 121,651,791 probably benign Het
Zfp800 A G 6: 28,243,719 S416P probably benign Het
Other mutations in Fam135a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Fam135a APN 1 24055898 missense probably damaging 1.00
IGL01993:Fam135a APN 1 24055911 missense probably damaging 0.99
IGL02172:Fam135a APN 1 24024780 critical splice donor site probably null
IGL02832:Fam135a APN 1 24028633 missense probably benign 0.00
IGL03075:Fam135a APN 1 24030906 splice site probably benign
IGL03197:Fam135a APN 1 24044182 missense probably damaging 1.00
IGL03214:Fam135a APN 1 24053276 missense probably damaging 1.00
IGL03355:Fam135a APN 1 24029168 missense possibly damaging 0.93
PIT4434001:Fam135a UTSW 1 24029195 missense probably benign
R0276:Fam135a UTSW 1 24067964 missense probably damaging 1.00
R1429:Fam135a UTSW 1 24044267 missense probably damaging 1.00
R1553:Fam135a UTSW 1 24021870 missense probably damaging 0.97
R1582:Fam135a UTSW 1 24029317 missense probably damaging 1.00
R1686:Fam135a UTSW 1 24029806 missense probably benign 0.05
R1732:Fam135a UTSW 1 24026653 missense possibly damaging 0.71
R1859:Fam135a UTSW 1 24030225 missense probably damaging 1.00
R1954:Fam135a UTSW 1 24029602 missense probably damaging 1.00
R2266:Fam135a UTSW 1 24028797 missense probably benign 0.22
R2570:Fam135a UTSW 1 24021964 missense probably damaging 1.00
R3725:Fam135a UTSW 1 24057434 nonsense probably null
R3740:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3741:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3765:Fam135a UTSW 1 24055877 missense possibly damaging 0.95
R3792:Fam135a UTSW 1 24028311 missense probably benign 0.14
R3940:Fam135a UTSW 1 24057475 missense probably damaging 0.98
R3946:Fam135a UTSW 1 24030394 missense probably damaging 0.96
R4754:Fam135a UTSW 1 24028754 nonsense probably null
R4794:Fam135a UTSW 1 24029160 missense probably benign 0.36
R4887:Fam135a UTSW 1 24024253 nonsense probably null
R4891:Fam135a UTSW 1 24030328 missense probably benign 0.00
R4929:Fam135a UTSW 1 24030000 missense probably benign 0.16
R4999:Fam135a UTSW 1 24020677 missense possibly damaging 0.83
R5092:Fam135a UTSW 1 24028807 missense probably benign 0.11
R5205:Fam135a UTSW 1 24029511 missense probably benign 0.05
R5313:Fam135a UTSW 1 24028585 missense possibly damaging 0.89
R5579:Fam135a UTSW 1 24029727 missense possibly damaging 0.93
R5689:Fam135a UTSW 1 24029053 missense probably benign 0.22
R5863:Fam135a UTSW 1 24014782 missense possibly damaging 0.94
R5869:Fam135a UTSW 1 24029430 missense possibly damaging 0.53
R6128:Fam135a UTSW 1 24030740 critical splice donor site probably null
R6505:Fam135a UTSW 1 24014872 missense probably damaging 1.00
R6668:Fam135a UTSW 1 24028848 missense probably damaging 0.99
R6793:Fam135a UTSW 1 24067925 missense possibly damaging 0.69
R6857:Fam135a UTSW 1 24014789 missense probably damaging 0.99
R6931:Fam135a UTSW 1 24085487 start codon destroyed probably damaging 1.00
R6977:Fam135a UTSW 1 24054098 missense probably damaging 1.00
R7187:Fam135a UTSW 1 24044214 missense probably damaging 1.00
R7206:Fam135a UTSW 1 24030273 missense probably benign 0.14
R7305:Fam135a UTSW 1 24030858 missense probably damaging 1.00
R7313:Fam135a UTSW 1 24057392 missense probably damaging 0.98
R7646:Fam135a UTSW 1 24028623 missense probably benign 0.06
R7661:Fam135a UTSW 1 24072762 splice site probably null
R7681:Fam135a UTSW 1 24067915 missense probably benign 0.03
R7748:Fam135a UTSW 1 24028969 missense probably benign 0.00
R7845:Fam135a UTSW 1 24029657 missense probably benign 0.27
R7849:Fam135a UTSW 1 24044250 missense probably damaging 1.00
R7914:Fam135a UTSW 1 24026679 missense probably damaging 1.00
R8314:Fam135a UTSW 1 24021921 missense possibly damaging 0.84
X0022:Fam135a UTSW 1 24030214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAATATTTGAGGGCGGCAACC -3'
(R):5'- ATTTGAGCTGGCCAGGAAAG -3'

Sequencing Primer
(F):5'- GCGGCAACCAGGAAAAACTTCTC -3'
(R):5'- GCCAGGAAAGGTGTTATTATGAATTC -3'
Posted On2019-10-07