Incidental Mutation 'R7420:Olfr694'
ID575601
Institutional Source Beutler Lab
Gene Symbol Olfr694
Ensembl Gene ENSMUSG00000064223
Gene Nameolfactory receptor 694
SynonymsMOR283-9, GA_x6K02T2PBJ9-9067220-9066273
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7420 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106684980-106691814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106689020 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 237 (A237V)
Ref Sequence ENSEMBL: ENSMUSP00000057180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052535] [ENSMUST00000082091] [ENSMUST00000216118] [ENSMUST00000216895]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052535
AA Change: A237V

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057180
Gene: ENSMUSG00000064223
AA Change: A237V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.1e-43 PFAM
Pfam:7tm_1 41 290 9.1e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082091
AA Change: A237V

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080740
Gene: ENSMUSG00000064223
AA Change: A237V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.6e-6 PFAM
Pfam:7tm_1 41 290 7.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216118
AA Change: A237V

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216895
AA Change: A237V

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 C T 13: 64,297,317 G164D possibly damaging Het
Abca6 A G 11: 110,250,477 V6A probably benign Het
Adam29 T A 8: 55,872,898 M174L probably benign Het
Ano1 G A 7: 144,655,641 T274I probably benign Het
Atad5 A T 11: 80,095,862 T592S probably benign Het
Bud13 C T 9: 46,287,815 P158L probably benign Het
Card19 T C 13: 49,208,137 Y6C probably damaging Het
Cd36 C G 5: 17,788,274 V393L probably benign Het
Cd79a A T 7: 24,897,546 R9* probably null Het
Cep164 T C 9: 45,768,542 H1131R probably benign Het
Chia1 T A 3: 106,130,664 S321T probably benign Het
Chrnd T A 1: 87,194,821 V217E possibly damaging Het
Cmtm7 T C 9: 114,763,394 probably null Het
Csn1s2a T C 5: 87,780,006 S60P possibly damaging Het
Defa30 T A 8: 21,135,455 N78K probably benign Het
Dnah2 C T 11: 69,478,797 A1618T possibly damaging Het
Dnah9 A G 11: 66,117,407 probably null Het
Epn1 A T 7: 5,097,688 T546S possibly damaging Het
Fam135a A G 1: 24,012,486 S1443P possibly damaging Het
Fam13b G T 18: 34,494,611 P179Q probably damaging Het
Git2 T C 5: 114,730,370 T647A probably benign Het
Gli2 T C 1: 118,835,939 N1494S probably benign Het
Gm4952 G A 19: 12,626,901 G226R probably damaging Het
Gm5460 T A 14: 34,036,757 F156I probably damaging Het
Gm884 A T 11: 103,613,625 S2506T probably benign Het
Heatr5b A T 17: 78,808,480 V849D probably damaging Het
Hepacam A G 9: 37,380,709 D111G probably benign Het
Hk1 T C 10: 62,269,982 D895G probably damaging Het
Kdm5b T C 1: 134,604,497 V471A probably benign Het
Klhdc8b A G 9: 108,449,118 Y239H possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt82 T C 15: 101,545,587 T229A probably damaging Het
Lztr1 T C 16: 17,524,129 L656P probably damaging Het
Mfrp T C 9: 44,102,476 probably benign Het
Mrvi1 A T 7: 110,871,473 Y678* probably null Het
Nfe2l1 A G 11: 96,819,913 S497P probably benign Het
Olfr907 G T 9: 38,499,063 L131F probably benign Het
Otud4 C A 8: 79,664,108 T418K probably benign Het
Pcdhb21 A G 18: 37,515,203 N462D probably damaging Het
Plch1 A G 3: 63,722,857 S497P probably damaging Het
Plekha8 T C 6: 54,613,194 V48A probably damaging Het
Ppp2r5d A T 17: 46,687,581 F121L probably null Het
Sdad1 G A 5: 92,305,737 A64V possibly damaging Het
Selenop G T 15: 3,279,570 A335S probably damaging Het
Shc3 T C 13: 51,431,235 N448S probably benign Het
Shcbp1 G A 8: 4,748,737 T394I probably benign Het
Slc39a11 G T 11: 113,247,822 A276E probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Speg T A 1: 75,430,905 S3185R probably damaging Het
Tmem100 A T 11: 90,035,753 *135Y probably null Het
Ube2o A T 11: 116,540,072 F1001I probably damaging Het
Usp7 T C 16: 8,710,121 D148G probably benign Het
Vmn2r16 A G 5: 109,363,870 T648A probably damaging Het
Vmn2r67 A G 7: 85,136,736 L687P possibly damaging Het
Zcchc14 ACCGCCGCCGCCGCCGCC ACCGCCGCCGCCGCC 8: 121,651,791 probably benign Het
Zfp800 A G 6: 28,243,719 S416P probably benign Het
Other mutations in Olfr694
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr694 APN 7 106689531 missense probably damaging 1.00
IGL01759:Olfr694 APN 7 106689333 missense probably benign 0.04
IGL02435:Olfr694 APN 7 106689503 missense probably benign 0.26
IGL02569:Olfr694 APN 7 106689642 missense probably benign 0.19
IGL02611:Olfr694 APN 7 106688789 missense probably benign 0.11
IGL02726:Olfr694 APN 7 106689370 nonsense probably null
IGL02944:Olfr694 APN 7 106689269 missense probably damaging 1.00
IGL03155:Olfr694 APN 7 106689239 missense probably damaging 1.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0609:Olfr694 UTSW 7 106688998 missense probably damaging 1.00
R0655:Olfr694 UTSW 7 106689425 missense probably damaging 1.00
R1562:Olfr694 UTSW 7 106688980 missense probably benign 0.01
R1641:Olfr694 UTSW 7 106689711 missense probably benign 0.36
R2144:Olfr694 UTSW 7 106688957 missense probably damaging 0.99
R4416:Olfr694 UTSW 7 106689011 missense probably benign 0.07
R4444:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4445:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4567:Olfr694 UTSW 7 106689213 nonsense probably null
R4739:Olfr694 UTSW 7 106689144 nonsense probably null
R4778:Olfr694 UTSW 7 106689667 missense probably damaging 0.97
R4908:Olfr694 UTSW 7 106689533 missense probably damaging 1.00
R5244:Olfr694 UTSW 7 106689189 missense probably benign 0.12
R5944:Olfr694 UTSW 7 106689646 nonsense probably null
R6260:Olfr694 UTSW 7 106688872 missense probably damaging 1.00
R6573:Olfr694 UTSW 7 106689463 missense probably benign 0.00
R6901:Olfr694 UTSW 7 106689189 missense probably benign 0.03
R7230:Olfr694 UTSW 7 106689524 missense possibly damaging 0.94
R7426:Olfr694 UTSW 7 106689210 missense possibly damaging 0.88
U24488:Olfr694 UTSW 7 106689089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCTTTTCCCCAGGACTC -3'
(R):5'- AGACACCTCTTCTGTGAGATTCC -3'

Sequencing Primer
(F):5'- AAAGCCCCAGTGACCTCCTTATTC -3'
(R):5'- GTGAGATTCCTCCCTTGCTAAAG -3'
Posted On2019-10-07