Incidental Mutation 'R7420:Hepacam'
ID575609
Institutional Source Beutler Lab
Gene Symbol Hepacam
Ensembl Gene ENSMUSG00000046240
Gene Namehepatocyte cell adhesion molecule
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7420 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37367351-37386575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37380709 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 111 (D111G)
Ref Sequence ENSEMBL: ENSMUSP00000054105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051839] [ENSMUST00000215951]
Predicted Effect probably benign
Transcript: ENSMUST00000051839
AA Change: D111G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000054105
Gene: ENSMUSG00000046240
AA Change: D111G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IG 40 142 1e-3 SMART
IGc2 159 224 1.48e-6 SMART
transmembrane domain 241 263 N/A INTRINSIC
low complexity region 264 274 N/A INTRINSIC
low complexity region 337 356 N/A INTRINSIC
low complexity region 358 372 N/A INTRINSIC
low complexity region 379 396 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000215951
AA Change: T30A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein that localizes to the cytoplasmic side of the cell membrane. The encoded protein acts as a homodimer and is involved in cell motility and cell-matrix interactions. The expression of this gene is downregulated or undetectable in many cancer cell lines, so this may be a tumor suppressor gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele display myelin vacuolization that progresses with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 C T 13: 64,297,317 G164D possibly damaging Het
Abca6 A G 11: 110,250,477 V6A probably benign Het
Adam29 T A 8: 55,872,898 M174L probably benign Het
Ano1 G A 7: 144,655,641 T274I probably benign Het
Atad5 A T 11: 80,095,862 T592S probably benign Het
Bud13 C T 9: 46,287,815 P158L probably benign Het
Card19 T C 13: 49,208,137 Y6C probably damaging Het
Cd36 C G 5: 17,788,274 V393L probably benign Het
Cd79a A T 7: 24,897,546 R9* probably null Het
Cep164 T C 9: 45,768,542 H1131R probably benign Het
Chia1 T A 3: 106,130,664 S321T probably benign Het
Chrnd T A 1: 87,194,821 V217E possibly damaging Het
Cmtm7 T C 9: 114,763,394 probably null Het
Csn1s2a T C 5: 87,780,006 S60P possibly damaging Het
Defa30 T A 8: 21,135,455 N78K probably benign Het
Dnah2 C T 11: 69,478,797 A1618T possibly damaging Het
Dnah9 A G 11: 66,117,407 probably null Het
Epn1 A T 7: 5,097,688 T546S possibly damaging Het
Fam135a A G 1: 24,012,486 S1443P possibly damaging Het
Fam13b G T 18: 34,494,611 P179Q probably damaging Het
Git2 T C 5: 114,730,370 T647A probably benign Het
Gli2 T C 1: 118,835,939 N1494S probably benign Het
Gm4952 G A 19: 12,626,901 G226R probably damaging Het
Gm5460 T A 14: 34,036,757 F156I probably damaging Het
Gm884 A T 11: 103,613,625 S2506T probably benign Het
Heatr5b A T 17: 78,808,480 V849D probably damaging Het
Hk1 T C 10: 62,269,982 D895G probably damaging Het
Kdm5b T C 1: 134,604,497 V471A probably benign Het
Klhdc8b A G 9: 108,449,118 Y239H possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt82 T C 15: 101,545,587 T229A probably damaging Het
Lztr1 T C 16: 17,524,129 L656P probably damaging Het
Mfrp T C 9: 44,102,476 probably benign Het
Mrvi1 A T 7: 110,871,473 Y678* probably null Het
Nfe2l1 A G 11: 96,819,913 S497P probably benign Het
Olfr694 G A 7: 106,689,020 A237V possibly damaging Het
Olfr907 G T 9: 38,499,063 L131F probably benign Het
Otud4 C A 8: 79,664,108 T418K probably benign Het
Pcdhb21 A G 18: 37,515,203 N462D probably damaging Het
Plch1 A G 3: 63,722,857 S497P probably damaging Het
Plekha8 T C 6: 54,613,194 V48A probably damaging Het
Ppp2r5d A T 17: 46,687,581 F121L probably null Het
Sdad1 G A 5: 92,305,737 A64V possibly damaging Het
Selenop G T 15: 3,279,570 A335S probably damaging Het
Shc3 T C 13: 51,431,235 N448S probably benign Het
Shcbp1 G A 8: 4,748,737 T394I probably benign Het
Slc39a11 G T 11: 113,247,822 A276E probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Speg T A 1: 75,430,905 S3185R probably damaging Het
Tmem100 A T 11: 90,035,753 *135Y probably null Het
Ube2o A T 11: 116,540,072 F1001I probably damaging Het
Usp7 T C 16: 8,710,121 D148G probably benign Het
Vmn2r16 A G 5: 109,363,870 T648A probably damaging Het
Vmn2r67 A G 7: 85,136,736 L687P possibly damaging Het
Zcchc14 ACCGCCGCCGCCGCCGCC ACCGCCGCCGCCGCC 8: 121,651,791 probably benign Het
Zfp800 A G 6: 28,243,719 S416P probably benign Het
Other mutations in Hepacam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Hepacam APN 9 37380616 missense probably damaging 1.00
R0924:Hepacam UTSW 9 37383928 splice site probably benign
R1659:Hepacam UTSW 9 37380658 missense probably benign 0.08
R1748:Hepacam UTSW 9 37383893 missense possibly damaging 0.90
R4932:Hepacam UTSW 9 37381764 missense probably damaging 1.00
R5587:Hepacam UTSW 9 37384684 missense probably damaging 0.99
R5738:Hepacam UTSW 9 37383425 missense possibly damaging 0.83
R5809:Hepacam UTSW 9 37384805 missense possibly damaging 0.49
R6017:Hepacam UTSW 9 37380760 missense probably benign 0.00
R6825:Hepacam UTSW 9 37367680 missense possibly damaging 0.67
R7825:Hepacam UTSW 9 37384768 missense probably benign 0.03
X0024:Hepacam UTSW 9 37381600 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTTCCGTGCAGTACAGTAGCAC -3'
(R):5'- TGGGCCTCTATCCATGTTAGC -3'

Sequencing Primer
(F):5'- TGCAGTACAGTAGCACCAGCAG -3'
(R):5'- ATGTTAGCTGTGCCTAGGTACCAC -3'
Posted On2019-10-07