Incidental Mutation 'R7420:Dnah2'
ID575617
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Namedynein, axonemal, heavy chain 2
SynonymsDnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7420 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69420809-69549110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69478797 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1618 (A1618T)
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
Predicted Effect probably damaging
Transcript: ENSMUST00000035539
AA Change: A1618T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: A1618T

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108659
AA Change: A1618T

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: A1618T

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 C T 13: 64,297,317 G164D possibly damaging Het
Abca6 A G 11: 110,250,477 V6A probably benign Het
Adam29 T A 8: 55,872,898 M174L probably benign Het
Ano1 G A 7: 144,655,641 T274I probably benign Het
Atad5 A T 11: 80,095,862 T592S probably benign Het
Bud13 C T 9: 46,287,815 P158L probably benign Het
Card19 T C 13: 49,208,137 Y6C probably damaging Het
Cd36 C G 5: 17,788,274 V393L probably benign Het
Cd79a A T 7: 24,897,546 R9* probably null Het
Cep164 T C 9: 45,768,542 H1131R probably benign Het
Chia1 T A 3: 106,130,664 S321T probably benign Het
Chrnd T A 1: 87,194,821 V217E possibly damaging Het
Cmtm7 T C 9: 114,763,394 probably null Het
Csn1s2a T C 5: 87,780,006 S60P possibly damaging Het
Defa30 T A 8: 21,135,455 N78K probably benign Het
Dnah9 A G 11: 66,117,407 probably null Het
Epn1 A T 7: 5,097,688 T546S possibly damaging Het
Fam135a A G 1: 24,012,486 S1443P possibly damaging Het
Fam13b G T 18: 34,494,611 P179Q probably damaging Het
Git2 T C 5: 114,730,370 T647A probably benign Het
Gli2 T C 1: 118,835,939 N1494S probably benign Het
Gm4952 G A 19: 12,626,901 G226R probably damaging Het
Gm5460 T A 14: 34,036,757 F156I probably damaging Het
Gm884 A T 11: 103,613,625 S2506T probably benign Het
Heatr5b A T 17: 78,808,480 V849D probably damaging Het
Hepacam A G 9: 37,380,709 D111G probably benign Het
Hk1 T C 10: 62,269,982 D895G probably damaging Het
Kdm5b T C 1: 134,604,497 V471A probably benign Het
Klhdc8b A G 9: 108,449,118 Y239H possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt82 T C 15: 101,545,587 T229A probably damaging Het
Lztr1 T C 16: 17,524,129 L656P probably damaging Het
Mrvi1 A T 7: 110,871,473 Y678* probably null Het
Nfe2l1 A G 11: 96,819,913 S497P probably benign Het
Olfr694 G A 7: 106,689,020 A237V possibly damaging Het
Olfr907 G T 9: 38,499,063 L131F probably benign Het
Otud4 C A 8: 79,664,108 T418K probably benign Het
Pcdhb21 A G 18: 37,515,203 N462D probably damaging Het
Plch1 A G 3: 63,722,857 S497P probably damaging Het
Plekha8 T C 6: 54,613,194 V48A probably damaging Het
Ppp2r5d A T 17: 46,687,581 F121L probably null Het
Sdad1 G A 5: 92,305,737 A64V possibly damaging Het
Selenop G T 15: 3,279,570 A335S probably damaging Het
Shc3 T C 13: 51,431,235 N448S probably benign Het
Shcbp1 G A 8: 4,748,737 T394I probably benign Het
Slc39a11 G T 11: 113,247,822 A276E probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Speg T A 1: 75,430,905 S3185R probably damaging Het
Tmem100 A T 11: 90,035,753 *135Y probably null Het
Ube2o A T 11: 116,540,072 F1001I probably damaging Het
Usp7 T C 16: 8,710,121 D148G probably benign Het
Vmn2r16 A G 5: 109,363,870 T648A probably damaging Het
Vmn2r67 A G 7: 85,136,736 L687P possibly damaging Het
Zcchc14 ACCGCCGCCGCCGCCGCC ACCGCCGCCGCCGCC 8: 121,651,791 probably benign Het
Zfp800 A G 6: 28,243,719 S416P probably benign Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69492672 missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69495066 splice site probably benign
IGL00772:Dnah2 APN 11 69451257 missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69473350 critical splice donor site probably null
IGL00827:Dnah2 APN 11 69448457 missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69478092 missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69493184 missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69475606 missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69432964 missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69474191 splice site probably benign
IGL01480:Dnah2 APN 11 69458371 missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69516080 missense probably benign 0.17
IGL01592:Dnah2 APN 11 69431087 missense probably benign 0.14
IGL01612:Dnah2 APN 11 69465063 splice site probably benign
IGL01667:Dnah2 APN 11 69544395 missense probably benign
IGL01667:Dnah2 APN 11 69520941 missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69539443 missense probably benign
IGL02019:Dnah2 APN 11 69474285 missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69499212 missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69422559 missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69458185 missense probably benign 0.07
IGL02158:Dnah2 APN 11 69458123 missense probably benign
IGL02381:Dnah2 APN 11 69446292 missense probably benign 0.25
IGL02681:Dnah2 APN 11 69452933 missense probably benign 0.40
IGL02957:Dnah2 APN 11 69448507 missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69518414 missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69521187 missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69436291 splice site probably benign
IGL03120:Dnah2 APN 11 69421848 missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69458488 missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69459263 missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69529381 critical splice donor site probably null
IGL03333:Dnah2 APN 11 69495123 missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69496577 missense probably benign 0.13
argyrios UTSW 11 69516590 missense possibly damaging 0.47
Aureus UTSW 11 69429348 missense probably damaging 1.00
platinum UTSW 11 69458042 missense probably damaging 0.96
E0370:Dnah2 UTSW 11 69515615 splice site probably null
P0026:Dnah2 UTSW 11 69464947 missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69421009 missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69435249 missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69436836 missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69529531 missense probably benign 0.00
R0386:Dnah2 UTSW 11 69447861 missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69499238 missense probably benign 0.26
R0427:Dnah2 UTSW 11 69452879 missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69459288 missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69448542 missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69459201 missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69423126 missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69499194 missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69477683 missense probably benign 0.07
R0924:Dnah2 UTSW 11 69421308 missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69448519 missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69447819 missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69446648 missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69499190 missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69515700 missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69451050 missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69520667 intron probably null
R1538:Dnah2 UTSW 11 69477202 missense probably benign 0.17
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1590:Dnah2 UTSW 11 69422754 critical splice donor site probably null
R1590:Dnah2 UTSW 11 69521198 missense probably benign 0.00
R1655:Dnah2 UTSW 11 69473854 missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69514691 missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69497889 missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69423543 missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69475574 missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69514804 missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69437886 missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69515752 missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69464930 missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69474325 missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69458358 critical splice donor site probably null
R2016:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69524240 missense probably benign 0.14
R2077:Dnah2 UTSW 11 69496606 missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69455916 missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69493237 missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2128:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2146:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2147:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2150:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2404:Dnah2 UTSW 11 69437221 missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69524206 nonsense probably null
R2517:Dnah2 UTSW 11 69516644 missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69430478 missense probably benign
R3741:Dnah2 UTSW 11 69448469 missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69492650 splice site probably null
R3872:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69451347 missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69454103 missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69484021 missense probably benign 0.00
R4501:Dnah2 UTSW 11 69477659 missense probably benign
R4515:Dnah2 UTSW 11 69465631 missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69483367 missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69463661 missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69465376 missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69496559 missense probably benign 0.00
R4683:Dnah2 UTSW 11 69458942 missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69498532 missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69478077 missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69516590 missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69476688 missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69429357 missense probably benign 0.00
R4740:Dnah2 UTSW 11 69458042 missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69473871 missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69423205 missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69422590 missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69463648 missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69476691 missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69521147 missense probably benign 0.00
R4911:Dnah2 UTSW 11 69499104 critical splice donor site probably null
R4954:Dnah2 UTSW 11 69539496 missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69455973 nonsense probably null
R5015:Dnah2 UTSW 11 69497882 missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69448166 missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69520773 missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69520933 missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69422536 missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69435884 missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5208:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5252:Dnah2 UTSW 11 69529469 missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5298:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5299:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5301:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5324:Dnah2 UTSW 11 69457993 missense probably benign 0.07
R5350:Dnah2 UTSW 11 69516036 missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69421848 missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69500857 missense probably benign
R5421:Dnah2 UTSW 11 69435636 missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69524383 missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69473351 critical splice donor site probably null
R5474:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5476:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5477:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5510:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5527:Dnah2 UTSW 11 69437188 nonsense probably null
R5566:Dnah2 UTSW 11 69516569 nonsense probably null
R5587:Dnah2 UTSW 11 69437242 missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5688:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5690:Dnah2 UTSW 11 69491544 missense probably benign 0.15
R5711:Dnah2 UTSW 11 69435390 missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69430817 missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5913:Dnah2 UTSW 11 69448430 missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5960:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5961:Dnah2 UTSW 11 69431148 missense probably damaging 1.00
R5961:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5977:Dnah2 UTSW 11 69520881 missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69500839 missense probably benign
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6050:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6086:Dnah2 UTSW 11 69516008 missense probably benign 0.30
R6115:Dnah2 UTSW 11 69446649 missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69518359 missense probably benign 0.29
R6159:Dnah2 UTSW 11 69458542 missense probably damaging 1.00
R6159:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6163:Dnah2 UTSW 11 69520903 nonsense probably null
R6171:Dnah2 UTSW 11 69423042 missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69457412 missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69491641 missense probably benign 0.25
R6352:Dnah2 UTSW 11 69448227 missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69458518 missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69539415 missense probably benign
R6478:Dnah2 UTSW 11 69516010 missense probably benign 0.01
R6516:Dnah2 UTSW 11 69465386 missense probably benign 0.34
R6538:Dnah2 UTSW 11 69437197 missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69423690 missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69455963 missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69429471 missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69484260 missense probably benign 0.12
R6935:Dnah2 UTSW 11 69421741 missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69491547 nonsense probably null
R7073:Dnah2 UTSW 11 69430492 nonsense probably null
R7111:Dnah2 UTSW 11 69446753 splice site probably null
R7125:Dnah2 UTSW 11 69436182 missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69491555 missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69549097 utr 5 prime probably null
R7214:Dnah2 UTSW 11 69431109 missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69421396 missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69459146 critical splice donor site probably null
R7256:Dnah2 UTSW 11 69431094 missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69500817 missense probably damaging 1.00
R7421:Dnah2 UTSW 11 69492805 missense probably benign 0.25
R7437:Dnah2 UTSW 11 69498627 missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7473:Dnah2 UTSW 11 69491658 missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69500796 missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7615:Dnah2 UTSW 11 69435304 missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69498685 missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69451318 nonsense probably null
R7764:Dnah2 UTSW 11 69458158 missense probably benign 0.29
R7793:Dnah2 UTSW 11 69495214 missense probably benign 0.00
R7819:Dnah2 UTSW 11 69516593 missense probably benign 0.01
RF004:Dnah2 UTSW 11 69437187 missense probably benign 0.24
U24488:Dnah2 UTSW 11 69483822 missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69448562 missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69430793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAATGTTCTCCCTGGGAAG -3'
(R):5'- TTCCAGAAGTGGCAACGTTGA -3'

Sequencing Primer
(F):5'- AAATGTTCTCCCTGGGAAGTCCTTTC -3'
(R):5'- GGGTAGCTCATAACCATCTCTGATG -3'
Posted On2019-10-07