Incidental Mutation 'R7420:Fam13b'
ID 575637
Institutional Source Beutler Lab
Gene Symbol Fam13b
Ensembl Gene ENSMUSG00000036501
Gene Name family with sequence similarity 13, member B
Synonyms 2610024E20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R7420 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 34442352-34506823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 34494611 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 179 (P179Q)
Ref Sequence ENSEMBL: ENSMUSP00000038199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040506]
AlphaFold Q8K2H3
Predicted Effect probably damaging
Transcript: ENSMUST00000040506
AA Change: P179Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501
AA Change: P179Q

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Meta Mutation Damage Score 0.7412 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 C T 13: 64,297,317 G164D possibly damaging Het
Abca6 A G 11: 110,250,477 V6A probably benign Het
Adam29 T A 8: 55,872,898 M174L probably benign Het
Ano1 G A 7: 144,655,641 T274I probably benign Het
Atad5 A T 11: 80,095,862 T592S probably benign Het
Bud13 C T 9: 46,287,815 P158L probably benign Het
Card19 T C 13: 49,208,137 Y6C probably damaging Het
Cd36 C G 5: 17,788,274 V393L probably benign Het
Cd79a A T 7: 24,897,546 R9* probably null Het
Cep164 T C 9: 45,768,542 H1131R probably benign Het
Chia1 T A 3: 106,130,664 S321T probably benign Het
Chrnd T A 1: 87,194,821 V217E possibly damaging Het
Cmtm7 T C 9: 114,763,394 probably null Het
Csn1s2a T C 5: 87,780,006 S60P possibly damaging Het
Defa30 T A 8: 21,135,455 N78K probably benign Het
Dnah2 C T 11: 69,478,797 A1618T possibly damaging Het
Dnah9 A G 11: 66,117,407 probably null Het
Epn1 A T 7: 5,097,688 T546S possibly damaging Het
Fam135a A G 1: 24,012,486 S1443P possibly damaging Het
Git2 T C 5: 114,730,370 T647A probably benign Het
Gli2 T C 1: 118,835,939 N1494S probably benign Het
Gm4952 G A 19: 12,626,901 G226R probably damaging Het
Gm5460 T A 14: 34,036,757 F156I probably damaging Het
Gm884 A T 11: 103,613,625 S2506T probably benign Het
Heatr5b A T 17: 78,808,480 V849D probably damaging Het
Hepacam A G 9: 37,380,709 D111G probably benign Het
Hk1 T C 10: 62,269,982 D895G probably damaging Het
Kdm5b T C 1: 134,604,497 V471A probably benign Het
Klhdc8b A G 9: 108,449,118 Y239H possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt82 T C 15: 101,545,587 T229A probably damaging Het
Lztr1 T C 16: 17,524,129 L656P probably damaging Het
Mfrp T C 9: 44,102,476 probably benign Het
Mrvi1 A T 7: 110,871,473 Y678* probably null Het
Nfe2l1 A G 11: 96,819,913 S497P probably benign Het
Olfr694 G A 7: 106,689,020 A237V possibly damaging Het
Olfr907 G T 9: 38,499,063 L131F probably benign Het
Otud4 C A 8: 79,664,108 T418K probably benign Het
Pcdhb21 A G 18: 37,515,203 N462D probably damaging Het
Plch1 A G 3: 63,722,857 S497P probably damaging Het
Plekha8 T C 6: 54,613,194 V48A probably damaging Het
Ppp2r5d A T 17: 46,687,581 F121L probably null Het
Sdad1 G A 5: 92,305,737 A64V possibly damaging Het
Selenop G T 15: 3,279,570 A335S probably damaging Het
Shc3 T C 13: 51,431,235 N448S probably benign Het
Shcbp1 G A 8: 4,748,737 T394I probably benign Het
Slc39a11 G T 11: 113,247,822 A276E probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Speg T A 1: 75,430,905 S3185R probably damaging Het
Tmem100 A T 11: 90,035,753 *135Y probably null Het
Ube2o A T 11: 116,540,072 F1001I probably damaging Het
Usp7 T C 16: 8,710,121 D148G probably benign Het
Vmn2r16 A G 5: 109,363,870 T648A probably damaging Het
Vmn2r67 A G 7: 85,136,736 L687P possibly damaging Het
Zcchc14 ACCGCCGCCGCCGCCGCC ACCGCCGCCGCCGCC 8: 121,651,791 probably benign Het
Zfp800 A G 6: 28,243,719 S416P probably benign Het
Other mutations in Fam13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Fam13b APN 18 34487096 missense possibly damaging 0.92
IGL00402:Fam13b APN 18 34454718 missense probably damaging 1.00
IGL00556:Fam13b APN 18 34497435 missense probably damaging 0.99
IGL02123:Fam13b APN 18 34445618 unclassified probably benign
IGL02313:Fam13b APN 18 34454656 missense probably damaging 1.00
IGL02346:Fam13b APN 18 34462105 missense probably benign 0.00
IGL02347:Fam13b APN 18 34454704 missense probably damaging 1.00
IGL02694:Fam13b APN 18 34451206 critical splice donor site probably null
IGL03347:Fam13b APN 18 34462051 splice site probably benign
R0109:Fam13b UTSW 18 34451308 missense probably benign 0.00
R0233:Fam13b UTSW 18 34448084 missense probably damaging 1.00
R0455:Fam13b UTSW 18 34445528 unclassified probably benign
R1229:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1397:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1571:Fam13b UTSW 18 34497432 missense possibly damaging 0.92
R1703:Fam13b UTSW 18 34451439 critical splice acceptor site probably null
R1732:Fam13b UTSW 18 34487134 missense probably benign 0.04
R1777:Fam13b UTSW 18 34457760 missense possibly damaging 0.84
R1956:Fam13b UTSW 18 34445329 missense possibly damaging 0.69
R2296:Fam13b UTSW 18 34494761 missense possibly damaging 0.88
R3881:Fam13b UTSW 18 34462059 critical splice donor site probably null
R3896:Fam13b UTSW 18 34462955 splice site probably benign
R5277:Fam13b UTSW 18 34462190 missense probably benign
R5759:Fam13b UTSW 18 34497435 missense probably damaging 0.99
R5817:Fam13b UTSW 18 34457797 missense possibly damaging 0.93
R5897:Fam13b UTSW 18 34454081 missense possibly damaging 0.83
R6009:Fam13b UTSW 18 34497405 missense possibly damaging 0.92
R6020:Fam13b UTSW 18 34494774 missense probably damaging 1.00
R6087:Fam13b UTSW 18 34487139 missense possibly damaging 0.48
R6151:Fam13b UTSW 18 34494277 missense probably damaging 0.96
R6454:Fam13b UTSW 18 34457662 critical splice donor site probably null
R6464:Fam13b UTSW 18 34473631 nonsense probably null
R6679:Fam13b UTSW 18 34487022 missense possibly damaging 0.53
R6723:Fam13b UTSW 18 34498026 missense possibly damaging 0.86
R6990:Fam13b UTSW 18 34497447 missense possibly damaging 0.92
R7517:Fam13b UTSW 18 34494607 missense probably damaging 0.98
R7534:Fam13b UTSW 18 34498007 missense probably damaging 0.97
R7889:Fam13b UTSW 18 34457691 missense probably benign 0.00
R8139:Fam13b UTSW 18 34473633 missense possibly damaging 0.50
R8776:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8776-TAIL:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8826:Fam13b UTSW 18 34498017 missense probably damaging 0.96
R9166:Fam13b UTSW 18 34462199 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTACCCTGAACACAGCAATGC -3'
(R):5'- GAGCCTGGCAAAATATCTGAGC -3'

Sequencing Primer
(F):5'- TGAACACAGCAATGCTCTGAG -3'
(R):5'- GCCTGGCAAAATATCTGAGCTTTAC -3'
Posted On 2019-10-07