Incidental Mutation 'R7421:Pla2g4f'
ID575646
Institutional Source Beutler Lab
Gene Symbol Pla2g4f
Ensembl Gene ENSMUSG00000046971
Gene Namephospholipase A2, group IVF
Synonyms4732472I07Rik, Pla2zeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7421 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120299957-120314165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120307256 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 341 (M341T)
Ref Sequence ENSEMBL: ENSMUSP00000062607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054651]
Predicted Effect probably benign
Transcript: ENSMUST00000054651
AA Change: M341T

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000062607
Gene: ENSMUSG00000046971
AA Change: M341T

DomainStartEndE-ValueType
C2 45 144 7.51e-11 SMART
PLAc 285 797 1.6e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T C 2: 156,555,995 I309T possibly damaging Het
Abca12 A C 1: 71,247,136 L2513* probably null Het
Abca13 G C 11: 9,510,463 V4158L probably benign Het
Acaca A G 11: 84,363,736 T1880A possibly damaging Het
Arhgap5 C T 12: 52,518,000 R585C probably benign Het
Arsk A C 13: 76,062,515 I471S possibly damaging Het
Asb7 T C 7: 66,660,120 D116G probably damaging Het
Atad2 A G 15: 58,134,926 S17P probably benign Het
Atf5 T C 7: 44,815,138 E10G probably damaging Het
B3gntl1 G T 11: 121,624,178 P255T probably benign Het
Cacna1s A G 1: 136,086,802 N649S probably damaging Het
Ccnc A G 4: 21,743,291 Y192C probably damaging Het
Cd28 A G 1: 60,763,300 N126S probably benign Het
Cep57 A G 9: 13,810,673 S360P possibly damaging Het
Ces1e C T 8: 93,215,075 V257I probably benign Het
Chd1 A G 17: 15,749,398 K913R probably benign Het
Cluap1 A T 16: 3,940,793 D373V probably damaging Het
Cnmd T C 14: 79,645,507 I160V probably benign Het
Col6a4 G A 9: 106,020,795 P1686S probably damaging Het
Coro7 G T 16: 4,668,751 A186E probably benign Het
Cuta T C 17: 26,939,457 probably benign Het
Dnah2 G A 11: 69,492,805 H1098Y probably benign Het
Duox1 T A 2: 122,323,230 C345S probably damaging Het
Ephb4 T A 5: 137,354,425 I90K possibly damaging Het
Erich3 T A 3: 154,733,561 M280K probably damaging Het
Fcer2a T A 8: 3,690,335 H4L probably benign Het
Grk1 A T 8: 13,405,316 I67F probably damaging Het
Grm8 A C 6: 27,762,477 S250A possibly damaging Het
H2-Q6 A G 17: 35,425,228 E62G possibly damaging Het
Inppl1 C T 7: 101,832,937 R144H probably damaging Het
Itga3 G T 11: 95,068,855 P33Q probably benign Het
Itgax G A 7: 128,140,432 S672N probably damaging Het
Itpk1 A T 12: 102,574,065 V253E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Mrps7 T C 11: 115,604,891 V85A probably benign Het
Muc2 T C 7: 141,748,126 L427P Het
Mum1 T A 10: 80,232,753 S244T probably benign Het
Myef2 G T 2: 125,110,617 Q185K probably benign Het
Olfr1249 T A 2: 89,630,571 D109V probably damaging Het
Olfr22-ps1 G T 11: 73,955,509 C273F unknown Het
Pcdh15 G A 10: 74,454,065 M905I possibly damaging Het
Pgm5 C T 19: 24,709,299 V515M probably benign Het
Pik3r1 A G 13: 101,689,136 I381T probably damaging Het
Prmt2 A G 10: 76,221,078 F204L probably benign Het
Rasa2 A G 9: 96,611,447 V50A unknown Het
Scn7a A C 2: 66,675,532 I1671S probably benign Het
Sco2 G A 15: 89,371,720 R244C possibly damaging Het
Slfn1 A G 11: 83,121,141 M28V possibly damaging Het
Slfn9 A T 11: 82,981,371 C846* probably null Het
Slfn9 A G 11: 82,987,736 I189T probably damaging Het
Svil T A 18: 5,056,109 S327R probably benign Het
Tcaf3 A T 6: 42,596,842 N145K probably benign Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ttc37 A T 13: 76,148,825 K1100N probably benign Het
Tusc5 G A 11: 76,694,225 R147Q unknown Het
Upp2 G T 2: 58,771,574 V130F possibly damaging Het
Vnn3 G A 10: 23,865,768 A324T probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp39 A T 11: 58,890,107 C610S probably damaging Het
Other mutations in Pla2g4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Pla2g4f APN 2 120302738 missense possibly damaging 0.53
IGL01652:Pla2g4f APN 2 120302235 missense possibly damaging 0.86
IGL02792:Pla2g4f APN 2 120303369 missense probably damaging 1.00
R0625:Pla2g4f UTSW 2 120305041 missense probably damaging 1.00
R1760:Pla2g4f UTSW 2 120314066 unclassified probably benign
R1799:Pla2g4f UTSW 2 120311068 missense possibly damaging 0.49
R2212:Pla2g4f UTSW 2 120303106 missense probably benign
R2351:Pla2g4f UTSW 2 120300442 missense probably benign 0.01
R3412:Pla2g4f UTSW 2 120303106 missense probably benign
R3414:Pla2g4f UTSW 2 120303106 missense probably benign
R3906:Pla2g4f UTSW 2 120300499 missense probably benign 0.28
R4084:Pla2g4f UTSW 2 120312325 missense probably benign 0.36
R4477:Pla2g4f UTSW 2 120303672 missense probably damaging 1.00
R4529:Pla2g4f UTSW 2 120300619 missense probably damaging 0.99
R4606:Pla2g4f UTSW 2 120313986 missense probably benign 0.00
R4685:Pla2g4f UTSW 2 120305015 missense probably damaging 1.00
R4728:Pla2g4f UTSW 2 120300921 missense probably benign 0.19
R4782:Pla2g4f UTSW 2 120303276 missense probably damaging 1.00
R4957:Pla2g4f UTSW 2 120300499 missense probably benign 0.28
R5781:Pla2g4f UTSW 2 120305023 missense probably damaging 0.97
R6158:Pla2g4f UTSW 2 120301071 missense probably benign 0.21
R6232:Pla2g4f UTSW 2 120302221 missense possibly damaging 0.63
R6629:Pla2g4f UTSW 2 120308242 missense probably damaging 1.00
R6894:Pla2g4f UTSW 2 120303596 missense probably benign 0.44
R6939:Pla2g4f UTSW 2 120307301 missense probably damaging 1.00
R7131:Pla2g4f UTSW 2 120304554 missense probably null 0.01
R7221:Pla2g4f UTSW 2 120300995 missense probably benign 0.06
R7767:Pla2g4f UTSW 2 120305009 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCCAGGATTGTGTAAGTCCTC -3'
(R):5'- GTATTGTCTGTGAGGCTCCC -3'

Sequencing Primer
(F):5'- CAGGATTGTGTAAGTCCTCATTCCG -3'
(R):5'- TGAGGCTCCCCAGAATGTAGAC -3'
Posted On2019-10-07