Incidental Mutation 'R7421:Ccnc'
ID575651
Institutional Source Beutler Lab
Gene Symbol Ccnc
Ensembl Gene ENSMUSG00000028252
Gene Namecyclin C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7421 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location21727701-21759922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21743291 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 192 (Y192C)
Ref Sequence ENSEMBL: ENSMUSP00000100062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065928] [ENSMUST00000102997] [ENSMUST00000108240] [ENSMUST00000120679]
Predicted Effect probably damaging
Transcript: ENSMUST00000065928
AA Change: Y192C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069076
Gene: ENSMUSG00000028252
AA Change: Y192C

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102997
AA Change: Y192C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100062
Gene: ENSMUSG00000028252
AA Change: Y192C

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
low complexity region 258 264 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108240
AA Change: Y192C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103875
Gene: ENSMUSG00000028252
AA Change: Y192C

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120679
AA Change: Y192C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113682
Gene: ENSMUSG00000028252
AA Change: Y192C

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
low complexity region 258 264 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin family of proteins. The encoded protein interacts with cyclin-dependent kinase 8 and induces the phophorylation of the carboxy-terminal domain of the large subunit of RNA polymerase II. The level of mRNAs for this gene peaks in the G1 phase of the cell cycle. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die prenatally and exhibit growth retardation and placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T C 2: 156,555,995 I309T possibly damaging Het
Abca12 A C 1: 71,247,136 L2513* probably null Het
Abca13 G C 11: 9,510,463 V4158L probably benign Het
Acaca A G 11: 84,363,736 T1880A possibly damaging Het
Arhgap5 C T 12: 52,518,000 R585C probably benign Het
Arsk A C 13: 76,062,515 I471S possibly damaging Het
Asb7 T C 7: 66,660,120 D116G probably damaging Het
Atad2 A G 15: 58,134,926 S17P probably benign Het
Atf5 T C 7: 44,815,138 E10G probably damaging Het
B3gntl1 G T 11: 121,624,178 P255T probably benign Het
Cacna1s A G 1: 136,086,802 N649S probably damaging Het
Cd28 A G 1: 60,763,300 N126S probably benign Het
Cep57 A G 9: 13,810,673 S360P possibly damaging Het
Ces1e C T 8: 93,215,075 V257I probably benign Het
Chd1 A G 17: 15,749,398 K913R probably benign Het
Cluap1 A T 16: 3,940,793 D373V probably damaging Het
Cnmd T C 14: 79,645,507 I160V probably benign Het
Col6a4 G A 9: 106,020,795 P1686S probably damaging Het
Coro7 G T 16: 4,668,751 A186E probably benign Het
Cuta T C 17: 26,939,457 probably benign Het
Dnah2 G A 11: 69,492,805 H1098Y probably benign Het
Duox1 T A 2: 122,323,230 C345S probably damaging Het
Ephb4 T A 5: 137,354,425 I90K possibly damaging Het
Erich3 T A 3: 154,733,561 M280K probably damaging Het
Fcer2a T A 8: 3,690,335 H4L probably benign Het
Grk1 A T 8: 13,405,316 I67F probably damaging Het
Grm8 A C 6: 27,762,477 S250A possibly damaging Het
H2-Q6 A G 17: 35,425,228 E62G possibly damaging Het
Inppl1 C T 7: 101,832,937 R144H probably damaging Het
Itga3 G T 11: 95,068,855 P33Q probably benign Het
Itgax G A 7: 128,140,432 S672N probably damaging Het
Itpk1 A T 12: 102,574,065 V253E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Mrps7 T C 11: 115,604,891 V85A probably benign Het
Muc2 T C 7: 141,748,126 L427P Het
Mum1 T A 10: 80,232,753 S244T probably benign Het
Myef2 G T 2: 125,110,617 Q185K probably benign Het
Olfr1249 T A 2: 89,630,571 D109V probably damaging Het
Olfr22-ps1 G T 11: 73,955,509 C273F unknown Het
Pcdh15 G A 10: 74,454,065 M905I possibly damaging Het
Pgm5 C T 19: 24,709,299 V515M probably benign Het
Pik3r1 A G 13: 101,689,136 I381T probably damaging Het
Pla2g4f A G 2: 120,307,256 M341T probably benign Het
Prmt2 A G 10: 76,221,078 F204L probably benign Het
Rasa2 A G 9: 96,611,447 V50A unknown Het
Scn7a A C 2: 66,675,532 I1671S probably benign Het
Sco2 G A 15: 89,371,720 R244C possibly damaging Het
Slfn1 A G 11: 83,121,141 M28V possibly damaging Het
Slfn9 A T 11: 82,981,371 C846* probably null Het
Slfn9 A G 11: 82,987,736 I189T probably damaging Het
Svil T A 18: 5,056,109 S327R probably benign Het
Tcaf3 A T 6: 42,596,842 N145K probably benign Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ttc37 A T 13: 76,148,825 K1100N probably benign Het
Tusc5 G A 11: 76,694,225 R147Q unknown Het
Upp2 G T 2: 58,771,574 V130F possibly damaging Het
Vnn3 G A 10: 23,865,768 A324T probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp39 A T 11: 58,890,107 C610S probably damaging Het
Other mutations in Ccnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ccnc APN 4 21742642 nonsense probably null
IGL01536:Ccnc APN 4 21732505 missense probably benign 0.01
IGL03083:Ccnc APN 4 21742683 missense possibly damaging 0.83
R1220:Ccnc UTSW 4 21732491 missense probably damaging 1.00
R1237:Ccnc UTSW 4 21730457 missense probably benign
R1558:Ccnc UTSW 4 21742671 missense probably benign 0.31
R2012:Ccnc UTSW 4 21741955 missense possibly damaging 0.65
R4901:Ccnc UTSW 4 21727894 missense probably damaging 0.96
R6427:Ccnc UTSW 4 21747578 critical splice donor site probably null
R6509:Ccnc UTSW 4 21740642 missense probably benign 0.27
R7563:Ccnc UTSW 4 21732220 missense probably damaging 0.99
R7842:Ccnc UTSW 4 21730480 missense probably damaging 0.99
R7925:Ccnc UTSW 4 21730480 missense probably damaging 0.99
R8023:Ccnc UTSW 4 21747578 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCAGTAATGCCTGTCCCC -3'
(R):5'- AATAATGCTAATCTGGGATGGTTG -3'

Sequencing Primer
(F):5'- ACACTCATGCATTCCATTGCTTAG -3'
(R):5'- TGGTTGTAGTGTATATCATTGAGAAC -3'
Posted On2019-10-07