Incidental Mutation 'R7421:Wasf2'
ID575652
Institutional Source Beutler Lab
Gene Symbol Wasf2
Ensembl Gene ENSMUSG00000028868
Gene NameWAS protein family, member 2
SynonymsD4Ertd13e, WAVE2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7421 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location133130505-133199756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133185101 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 88 (E88G)
Ref Sequence ENSEMBL: ENSMUSP00000081263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084241] [ENSMUST00000105912] [ENSMUST00000138831]
Predicted Effect unknown
Transcript: ENSMUST00000084241
AA Change: E88G
SMART Domains Protein: ENSMUSP00000081263
Gene: ENSMUSG00000028868
AA Change: E88G

DomainStartEndE-ValueType
PDB:4N78|D 1 219 4e-90 PDB
low complexity region 243 263 N/A INTRINSIC
low complexity region 293 403 N/A INTRINSIC
low complexity region 411 419 N/A INTRINSIC
WH2 435 452 7.02e-5 SMART
low complexity region 481 497 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105912
AA Change: E88G
SMART Domains Protein: ENSMUSP00000101532
Gene: ENSMUSG00000028868
AA Change: E88G

DomainStartEndE-ValueType
PDB:4N78|D 1 219 4e-90 PDB
low complexity region 243 263 N/A INTRINSIC
low complexity region 293 403 N/A INTRINSIC
low complexity region 411 419 N/A INTRINSIC
WH2 435 452 7.02e-5 SMART
low complexity region 481 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138831
SMART Domains Protein: ENSMUSP00000117314
Gene: ENSMUSG00000028868

DomainStartEndE-ValueType
PDB:3P8C|D 1 85 6e-36 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. The published map location (PMID:10381382) has been changed based on recent genomic sequence comparisons, which indicate that the expressed gene is located on chromosome 1, and a pseudogene may be located on chromosome X. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutants show impaired embryonic development and do not survive to term. In addition to reduced embryo size, observed defects include hemorrhaging, abnormal somite development, perturbed angiogenesis, and shrunken cerebral ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T C 2: 156,555,995 I309T possibly damaging Het
Abca12 A C 1: 71,247,136 L2513* probably null Het
Abca13 G C 11: 9,510,463 V4158L probably benign Het
Acaca A G 11: 84,363,736 T1880A possibly damaging Het
Arhgap5 C T 12: 52,518,000 R585C probably benign Het
Arsk A C 13: 76,062,515 I471S possibly damaging Het
Asb7 T C 7: 66,660,120 D116G probably damaging Het
Atad2 A G 15: 58,134,926 S17P probably benign Het
Atf5 T C 7: 44,815,138 E10G probably damaging Het
B3gntl1 G T 11: 121,624,178 P255T probably benign Het
Cacna1s A G 1: 136,086,802 N649S probably damaging Het
Ccnc A G 4: 21,743,291 Y192C probably damaging Het
Cd28 A G 1: 60,763,300 N126S probably benign Het
Cep57 A G 9: 13,810,673 S360P possibly damaging Het
Ces1e C T 8: 93,215,075 V257I probably benign Het
Chd1 A G 17: 15,749,398 K913R probably benign Het
Cluap1 A T 16: 3,940,793 D373V probably damaging Het
Cnmd T C 14: 79,645,507 I160V probably benign Het
Col6a4 G A 9: 106,020,795 P1686S probably damaging Het
Coro7 G T 16: 4,668,751 A186E probably benign Het
Cuta T C 17: 26,939,457 probably benign Het
Dnah2 G A 11: 69,492,805 H1098Y probably benign Het
Duox1 T A 2: 122,323,230 C345S probably damaging Het
Ephb4 T A 5: 137,354,425 I90K possibly damaging Het
Erich3 T A 3: 154,733,561 M280K probably damaging Het
Fcer2a T A 8: 3,690,335 H4L probably benign Het
Grk1 A T 8: 13,405,316 I67F probably damaging Het
Grm8 A C 6: 27,762,477 S250A possibly damaging Het
H2-Q6 A G 17: 35,425,228 E62G possibly damaging Het
Inppl1 C T 7: 101,832,937 R144H probably damaging Het
Itga3 G T 11: 95,068,855 P33Q probably benign Het
Itgax G A 7: 128,140,432 S672N probably damaging Het
Itpk1 A T 12: 102,574,065 V253E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Mrps7 T C 11: 115,604,891 V85A probably benign Het
Muc2 T C 7: 141,748,126 L427P Het
Mum1 T A 10: 80,232,753 S244T probably benign Het
Myef2 G T 2: 125,110,617 Q185K probably benign Het
Olfr1249 T A 2: 89,630,571 D109V probably damaging Het
Olfr22-ps1 G T 11: 73,955,509 C273F unknown Het
Pcdh15 G A 10: 74,454,065 M905I possibly damaging Het
Pgm5 C T 19: 24,709,299 V515M probably benign Het
Pik3r1 A G 13: 101,689,136 I381T probably damaging Het
Pla2g4f A G 2: 120,307,256 M341T probably benign Het
Prmt2 A G 10: 76,221,078 F204L probably benign Het
Rasa2 A G 9: 96,611,447 V50A unknown Het
Scn7a A C 2: 66,675,532 I1671S probably benign Het
Sco2 G A 15: 89,371,720 R244C possibly damaging Het
Slfn1 A G 11: 83,121,141 M28V possibly damaging Het
Slfn9 A T 11: 82,981,371 C846* probably null Het
Slfn9 A G 11: 82,987,736 I189T probably damaging Het
Svil T A 18: 5,056,109 S327R probably benign Het
Tcaf3 A T 6: 42,596,842 N145K probably benign Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ttc37 A T 13: 76,148,825 K1100N probably benign Het
Tusc5 G A 11: 76,694,225 R147Q unknown Het
Upp2 G T 2: 58,771,574 V130F possibly damaging Het
Vnn3 G A 10: 23,865,768 A324T probably benign Het
Zfp39 A T 11: 58,890,107 C610S probably damaging Het
Other mutations in Wasf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Wasf2 APN 4 133192128 missense unknown
IGL02028:Wasf2 APN 4 133195801 missense probably damaging 1.00
IGL03196:Wasf2 APN 4 133194421 missense unknown
IGL03225:Wasf2 APN 4 133176546 missense probably benign
Syndrome UTSW 4 133194909 critical splice donor site probably null
R1551:Wasf2 UTSW 4 133190172 missense unknown
R1646:Wasf2 UTSW 4 133176591 missense probably benign 0.25
R4776:Wasf2 UTSW 4 133185004 missense probably benign
R4929:Wasf2 UTSW 4 133195859 missense unknown
R5042:Wasf2 UTSW 4 133176564 missense probably benign 0.37
R6803:Wasf2 UTSW 4 133194909 critical splice donor site probably null
R6889:Wasf2 UTSW 4 133194730 missense unknown
R7208:Wasf2 UTSW 4 133195734 missense probably damaging 1.00
R8477:Wasf2 UTSW 4 133185101 missense unknown
R8707:Wasf2 UTSW 4 133190229 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGCACTAGTGACTTGCTCTG -3'
(R):5'- ATCTTGCAGGCCTCTCCATG -3'

Sequencing Primer
(F):5'- GCACTAGTGACTTGCTCTGTTTGC -3'
(R):5'- CCTCTCCATGGGTGAAATGAGTC -3'
Posted On2019-10-07