Incidental Mutation 'R7421:Itgax'
ID575659
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R7421 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128140432 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 672 (S672N)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
Predicted Effect probably damaging
Transcript: ENSMUST00000033053
AA Change: S672N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: S672N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T C 2: 156,555,995 I309T possibly damaging Het
Abca12 A C 1: 71,247,136 L2513* probably null Het
Abca13 G C 11: 9,510,463 V4158L probably benign Het
Acaca A G 11: 84,363,736 T1880A possibly damaging Het
Arhgap5 C T 12: 52,518,000 R585C probably benign Het
Arsk A C 13: 76,062,515 I471S possibly damaging Het
Asb7 T C 7: 66,660,120 D116G probably damaging Het
Atad2 A G 15: 58,134,926 S17P probably benign Het
Atf5 T C 7: 44,815,138 E10G probably damaging Het
B3gntl1 G T 11: 121,624,178 P255T probably benign Het
Cacna1s A G 1: 136,086,802 N649S probably damaging Het
Ccnc A G 4: 21,743,291 Y192C probably damaging Het
Cd28 A G 1: 60,763,300 N126S probably benign Het
Cep57 A G 9: 13,810,673 S360P possibly damaging Het
Ces1e C T 8: 93,215,075 V257I probably benign Het
Chd1 A G 17: 15,749,398 K913R probably benign Het
Cluap1 A T 16: 3,940,793 D373V probably damaging Het
Cnmd T C 14: 79,645,507 I160V probably benign Het
Col6a4 G A 9: 106,020,795 P1686S probably damaging Het
Coro7 G T 16: 4,668,751 A186E probably benign Het
Cuta T C 17: 26,939,457 probably benign Het
Dnah2 G A 11: 69,492,805 H1098Y probably benign Het
Duox1 T A 2: 122,323,230 C345S probably damaging Het
Ephb4 T A 5: 137,354,425 I90K possibly damaging Het
Erich3 T A 3: 154,733,561 M280K probably damaging Het
Fcer2a T A 8: 3,690,335 H4L probably benign Het
Grk1 A T 8: 13,405,316 I67F probably damaging Het
Grm8 A C 6: 27,762,477 S250A possibly damaging Het
H2-Q6 A G 17: 35,425,228 E62G possibly damaging Het
Inppl1 C T 7: 101,832,937 R144H probably damaging Het
Itga3 G T 11: 95,068,855 P33Q probably benign Het
Itpk1 A T 12: 102,574,065 V253E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Mrps7 T C 11: 115,604,891 V85A probably benign Het
Muc2 T C 7: 141,748,126 L427P Het
Mum1 T A 10: 80,232,753 S244T probably benign Het
Myef2 G T 2: 125,110,617 Q185K probably benign Het
Olfr1249 T A 2: 89,630,571 D109V probably damaging Het
Olfr22-ps1 G T 11: 73,955,509 C273F unknown Het
Pcdh15 G A 10: 74,454,065 M905I possibly damaging Het
Pgm5 C T 19: 24,709,299 V515M probably benign Het
Pik3r1 A G 13: 101,689,136 I381T probably damaging Het
Pla2g4f A G 2: 120,307,256 M341T probably benign Het
Prmt2 A G 10: 76,221,078 F204L probably benign Het
Scn7a A C 2: 66,675,532 I1671S probably benign Het
Sco2 G A 15: 89,371,720 R244C possibly damaging Het
Slfn1 A G 11: 83,121,141 M28V possibly damaging Het
Slfn9 A T 11: 82,981,371 C846* probably null Het
Slfn9 A G 11: 82,987,736 I189T probably damaging Het
Svil T A 18: 5,056,109 S327R probably benign Het
Tcaf3 A T 6: 42,596,842 N145K probably benign Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ttc37 A T 13: 76,148,825 K1100N probably benign Het
Tusc5 G A 11: 76,694,225 R147Q unknown Het
Upp2 G T 2: 58,771,574 V130F possibly damaging Het
Vnn3 G A 10: 23,865,768 A324T probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp39 A T 11: 58,890,107 C610S probably damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6004:Itgax UTSW 7 128131452 missense probably damaging 0.96
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6796:Itgax UTSW 7 128135064 missense probably damaging 1.00
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7599:Itgax UTSW 7 128148090 missense probably damaging 0.99
R7710:Itgax UTSW 7 128135856 missense probably benign 0.04
X0061:Itgax UTSW 7 128129607 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCAGAGATTTCCAGGTCTGTG -3'
(R):5'- TCCCACAACCTATCTGGGTC -3'

Sequencing Primer
(F):5'- CCCTGAGCAGACACTGAGTGATG -3'
(R):5'- TATCTGGGTCCTCTCACCGGG -3'
Posted On2019-10-07