Incidental Mutation 'R7421:Prmt2'
ID575668
Institutional Source Beutler Lab
Gene Symbol Prmt2
Ensembl Gene ENSMUSG00000020230
Gene Nameprotein arginine N-methyltransferase 2
SynonymsHrmt1l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7421 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location76207222-76237865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76221078 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 204 (F204L)
Ref Sequence ENSEMBL: ENSMUSP00000097167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020452] [ENSMUST00000099571] [ENSMUST00000099572] [ENSMUST00000128099] [ENSMUST00000137857] [ENSMUST00000217726]
Predicted Effect probably benign
Transcript: ENSMUST00000020452
AA Change: F204L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000020452
Gene: ENSMUSG00000020230
AA Change: F204L

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 122 253 2.5e-8 PFAM
Pfam:PRMT5 123 427 2.4e-13 PFAM
Pfam:Met_10 127 244 5.1e-8 PFAM
Pfam:MTS 134 223 5.7e-11 PFAM
Pfam:Methyltransf_31 147 294 1.5e-8 PFAM
Pfam:Methyltransf_26 150 224 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099571
AA Change: F204L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097166
Gene: ENSMUSG00000020230
AA Change: F204L

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 122 253 2.5e-8 PFAM
Pfam:PRMT5 123 427 2.4e-13 PFAM
Pfam:Met_10 127 244 5.1e-8 PFAM
Pfam:MTS 134 223 5.7e-11 PFAM
Pfam:Methyltransf_31 147 294 1.5e-8 PFAM
Pfam:Methyltransf_26 150 224 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099572
AA Change: F204L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097167
Gene: ENSMUSG00000020230
AA Change: F204L

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 124 253 3.1e-8 PFAM
Pfam:PRMT5 124 451 1.2e-11 PFAM
Pfam:MTS 137 223 3.3e-10 PFAM
Pfam:Methyltransf_31 147 294 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128099
AA Change: F204L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000137707
Gene: ENSMUSG00000020230
AA Change: F204L

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 120 253 1.3e-9 PFAM
Pfam:Met_10 122 235 3.8e-8 PFAM
Pfam:TehB 122 235 6.9e-8 PFAM
Pfam:MTS 133 223 2e-11 PFAM
Pfam:Methyltransf_31 147 243 9.3e-9 PFAM
Pfam:Methyltransf_26 150 224 4.6e-10 PFAM
Pfam:Methyltransf_11 154 238 3.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137857
AA Change: F204L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000137725
Gene: ENSMUSG00000020230
AA Change: F204L

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 120 253 1.5e-9 PFAM
Pfam:Met_10 129 235 4.2e-7 PFAM
Pfam:MTS 137 223 1.1e-10 PFAM
Pfam:Methyltransf_31 147 243 9.2e-9 PFAM
Pfam:Methyltransf_11 154 237 1.7e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217726
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display a hyperplastic response to vascular injury while mutant mouse embryonic fibroblasts show an earlier S phase entry following release of serum starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T C 2: 156,555,995 I309T possibly damaging Het
Abca12 A C 1: 71,247,136 L2513* probably null Het
Abca13 G C 11: 9,510,463 V4158L probably benign Het
Acaca A G 11: 84,363,736 T1880A possibly damaging Het
Arhgap5 C T 12: 52,518,000 R585C probably benign Het
Arsk A C 13: 76,062,515 I471S possibly damaging Het
Asb7 T C 7: 66,660,120 D116G probably damaging Het
Atad2 A G 15: 58,134,926 S17P probably benign Het
Atf5 T C 7: 44,815,138 E10G probably damaging Het
B3gntl1 G T 11: 121,624,178 P255T probably benign Het
Cacna1s A G 1: 136,086,802 N649S probably damaging Het
Ccnc A G 4: 21,743,291 Y192C probably damaging Het
Cd28 A G 1: 60,763,300 N126S probably benign Het
Cep57 A G 9: 13,810,673 S360P possibly damaging Het
Ces1e C T 8: 93,215,075 V257I probably benign Het
Chd1 A G 17: 15,749,398 K913R probably benign Het
Cluap1 A T 16: 3,940,793 D373V probably damaging Het
Cnmd T C 14: 79,645,507 I160V probably benign Het
Col6a4 G A 9: 106,020,795 P1686S probably damaging Het
Coro7 G T 16: 4,668,751 A186E probably benign Het
Cuta T C 17: 26,939,457 probably benign Het
Dnah2 G A 11: 69,492,805 H1098Y probably benign Het
Duox1 T A 2: 122,323,230 C345S probably damaging Het
Ephb4 T A 5: 137,354,425 I90K possibly damaging Het
Erich3 T A 3: 154,733,561 M280K probably damaging Het
Fcer2a T A 8: 3,690,335 H4L probably benign Het
Grk1 A T 8: 13,405,316 I67F probably damaging Het
Grm8 A C 6: 27,762,477 S250A possibly damaging Het
H2-Q6 A G 17: 35,425,228 E62G possibly damaging Het
Inppl1 C T 7: 101,832,937 R144H probably damaging Het
Itga3 G T 11: 95,068,855 P33Q probably benign Het
Itgax G A 7: 128,140,432 S672N probably damaging Het
Itpk1 A T 12: 102,574,065 V253E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Mrps7 T C 11: 115,604,891 V85A probably benign Het
Muc2 T C 7: 141,748,126 L427P Het
Mum1 T A 10: 80,232,753 S244T probably benign Het
Myef2 G T 2: 125,110,617 Q185K probably benign Het
Olfr1249 T A 2: 89,630,571 D109V probably damaging Het
Olfr22-ps1 G T 11: 73,955,509 C273F unknown Het
Pcdh15 G A 10: 74,454,065 M905I possibly damaging Het
Pgm5 C T 19: 24,709,299 V515M probably benign Het
Pik3r1 A G 13: 101,689,136 I381T probably damaging Het
Pla2g4f A G 2: 120,307,256 M341T probably benign Het
Rasa2 A G 9: 96,611,447 V50A unknown Het
Scn7a A C 2: 66,675,532 I1671S probably benign Het
Sco2 G A 15: 89,371,720 R244C possibly damaging Het
Slfn1 A G 11: 83,121,141 M28V possibly damaging Het
Slfn9 A T 11: 82,981,371 C846* probably null Het
Slfn9 A G 11: 82,987,736 I189T probably damaging Het
Svil T A 18: 5,056,109 S327R probably benign Het
Tcaf3 A T 6: 42,596,842 N145K probably benign Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ttc37 A T 13: 76,148,825 K1100N probably benign Het
Tusc5 G A 11: 76,694,225 R147Q unknown Het
Upp2 G T 2: 58,771,574 V130F possibly damaging Het
Vnn3 G A 10: 23,865,768 A324T probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp39 A T 11: 58,890,107 C610S probably damaging Het
Other mutations in Prmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Prmt2 APN 10 76222493 missense probably damaging 1.00
IGL01663:Prmt2 APN 10 76217309 splice site probably null
IGL02015:Prmt2 APN 10 76226255 nonsense probably null
IGL03094:Prmt2 APN 10 76210390 splice site probably benign
R0352:Prmt2 UTSW 10 76208503 missense possibly damaging 0.89
R0617:Prmt2 UTSW 10 76208683 intron probably benign
R0831:Prmt2 UTSW 10 76207807 unclassified probably benign
R0885:Prmt2 UTSW 10 76222565 missense probably damaging 1.00
R1882:Prmt2 UTSW 10 76222468 missense probably benign 0.00
R2022:Prmt2 UTSW 10 76225458 nonsense probably null
R2312:Prmt2 UTSW 10 76226255 nonsense probably null
R2401:Prmt2 UTSW 10 76225415 nonsense probably null
R2408:Prmt2 UTSW 10 76208467 missense probably damaging 0.98
R3753:Prmt2 UTSW 10 76225303 missense probably benign 0.01
R4707:Prmt2 UTSW 10 76226221 missense probably damaging 0.96
R4785:Prmt2 UTSW 10 76226221 missense probably damaging 0.96
R4937:Prmt2 UTSW 10 76221008 missense probably damaging 1.00
R5072:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5073:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5074:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5851:Prmt2 UTSW 10 76236740 missense possibly damaging 0.61
R6084:Prmt2 UTSW 10 76210444 missense probably benign 0.23
R6120:Prmt2 UTSW 10 76209446 missense possibly damaging 0.51
R6239:Prmt2 UTSW 10 76222591 nonsense probably null
R6317:Prmt2 UTSW 10 76222517 missense probably benign 0.15
R6659:Prmt2 UTSW 10 76217374 missense possibly damaging 0.85
R7174:Prmt2 UTSW 10 76225339 missense probably benign 0.00
R7485:Prmt2 UTSW 10 76221004 nonsense probably null
R8326:Prmt2 UTSW 10 76217413 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGATTCCTCAGATGGGCCC -3'
(R):5'- TTTGAGAACAGAGGTCACATGC -3'

Sequencing Primer
(F):5'- CCCAGGGTGCTAGGTTCAGAAG -3'
(R):5'- CAGAGGTCACATGCCTCTC -3'
Posted On2019-10-07