Incidental Mutation 'R7421:Acaca'
ID 575678
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms LOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7421 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84129672-84401651 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84363736 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1880 (T1880A)
Ref Sequence ENSEMBL: ENSMUSP00000020843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201]
AlphaFold Q5SWU9
Predicted Effect possibly damaging
Transcript: ENSMUST00000020843
AA Change: T1880A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: T1880A

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103201
AA Change: T1880A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: T1880A

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Meta Mutation Damage Score 0.2317 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T C 2: 156,555,995 I309T possibly damaging Het
Abca12 A C 1: 71,247,136 L2513* probably null Het
Abca13 G C 11: 9,510,463 V4158L probably benign Het
Arhgap5 C T 12: 52,518,000 R585C probably benign Het
Arsk A C 13: 76,062,515 I471S possibly damaging Het
Asb7 T C 7: 66,660,120 D116G probably damaging Het
Atad2 A G 15: 58,134,926 S17P probably benign Het
Atf5 T C 7: 44,815,138 E10G probably damaging Het
B3gntl1 G T 11: 121,624,178 P255T probably benign Het
Cacna1s A G 1: 136,086,802 N649S probably damaging Het
Ccnc A G 4: 21,743,291 Y192C probably damaging Het
Cd28 A G 1: 60,763,300 N126S probably benign Het
Cep57 A G 9: 13,810,673 S360P possibly damaging Het
Ces1e C T 8: 93,215,075 V257I probably benign Het
Chd1 A G 17: 15,749,398 K913R probably benign Het
Cluap1 A T 16: 3,940,793 D373V probably damaging Het
Cnmd T C 14: 79,645,507 I160V probably benign Het
Col6a4 G A 9: 106,020,795 P1686S probably damaging Het
Coro7 G T 16: 4,668,751 A186E probably benign Het
Cuta T C 17: 26,939,457 probably benign Het
Dnah2 G A 11: 69,492,805 H1098Y probably benign Het
Duox1 T A 2: 122,323,230 C345S probably damaging Het
Ephb4 T A 5: 137,354,425 I90K possibly damaging Het
Erich3 T A 3: 154,733,561 M280K probably damaging Het
Fcer2a T A 8: 3,690,335 H4L probably benign Het
Grk1 A T 8: 13,405,316 I67F probably damaging Het
Grm8 A C 6: 27,762,477 S250A possibly damaging Het
H2-Q6 A G 17: 35,425,228 E62G possibly damaging Het
Inppl1 C T 7: 101,832,937 R144H probably damaging Het
Itga3 G T 11: 95,068,855 P33Q probably benign Het
Itgax G A 7: 128,140,432 S672N probably damaging Het
Itpk1 A T 12: 102,574,065 V253E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Mrps7 T C 11: 115,604,891 V85A probably benign Het
Muc2 T C 7: 141,748,126 L427P Het
Mum1 T A 10: 80,232,753 S244T probably benign Het
Myef2 G T 2: 125,110,617 Q185K probably benign Het
Olfr1249 T A 2: 89,630,571 D109V probably damaging Het
Olfr22-ps1 G T 11: 73,955,509 C273F unknown Het
Pcdh15 G A 10: 74,454,065 M905I possibly damaging Het
Pgm5 C T 19: 24,709,299 V515M probably benign Het
Pik3r1 A G 13: 101,689,136 I381T probably damaging Het
Pla2g4f A G 2: 120,307,256 M341T probably benign Het
Prmt2 A G 10: 76,221,078 F204L probably benign Het
Rasa2 A G 9: 96,611,447 V50A unknown Het
Scn7a A C 2: 66,675,532 I1671S probably benign Het
Sco2 G A 15: 89,371,720 R244C possibly damaging Het
Slfn1 A G 11: 83,121,141 M28V possibly damaging Het
Slfn9 A T 11: 82,981,371 C846* probably null Het
Slfn9 A G 11: 82,987,736 I189T probably damaging Het
Svil T A 18: 5,056,109 S327R probably benign Het
Tcaf3 A T 6: 42,596,842 N145K probably benign Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ttc37 A T 13: 76,148,825 K1100N probably benign Het
Tusc5 G A 11: 76,694,225 R147Q unknown Het
Upp2 G T 2: 58,771,574 V130F possibly damaging Het
Vnn3 G A 10: 23,865,768 A324T probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp39 A T 11: 58,890,107 C610S probably damaging Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
effervescence UTSW 11 84262474 missense probably benign 0.41
fizz UTSW 11 84245856 missense probably damaging 0.98
greenhouse UTSW 11 84338356 missense probably damaging 1.00
Serene UTSW 11 84311409 splice site probably null
Tranquil UTSW 11 84280461 missense probably damaging 1.00
vitamin UTSW 11 84280435 missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 splice site probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7471:Acaca UTSW 11 84277782 splice site probably null
R7519:Acaca UTSW 11 84245856 missense probably damaging 0.98
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
R7574:Acaca UTSW 11 84261588 missense probably benign
R7633:Acaca UTSW 11 84372639 missense probably benign 0.26
R7643:Acaca UTSW 11 84338356 missense probably damaging 1.00
R7664:Acaca UTSW 11 84245349 missense probably damaging 1.00
R7675:Acaca UTSW 11 84315916 missense probably benign 0.04
R7676:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R7729:Acaca UTSW 11 84371513 missense probably damaging 0.98
R7867:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7898:Acaca UTSW 11 84364449 critical splice donor site probably null
R7909:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R7915:Acaca UTSW 11 84276588 missense probably benign
R7956:Acaca UTSW 11 84320580 missense probably damaging 0.98
R8000:Acaca UTSW 11 84392231 missense possibly damaging 0.88
R8038:Acaca UTSW 11 84215904 missense probably damaging 1.00
R8545:Acaca UTSW 11 84345968 missense probably damaging 1.00
R8722:Acaca UTSW 11 84338457 missense possibly damaging 0.85
R9005:Acaca UTSW 11 84371584 missense probably damaging 0.99
R9130:Acaca UTSW 11 84311319 missense probably damaging 1.00
R9397:Acaca UTSW 11 84368725 missense probably damaging 1.00
R9489:Acaca UTSW 11 84293016 missense probably benign 0.01
R9540:Acaca UTSW 11 84243411 missense probably damaging 1.00
R9593:Acaca UTSW 11 84380513 nonsense probably null
R9605:Acaca UTSW 11 84293016 missense probably benign 0.01
R9634:Acaca UTSW 11 84293990 missense probably benign 0.00
R9720:Acaca UTSW 11 84263357 missense probably damaging 1.00
RF014:Acaca UTSW 11 84231724 missense probably benign 0.01
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Z1176:Acaca UTSW 11 84260720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAATCCTGGCAGTCCCTC -3'
(R):5'- CAAGAGAAAGAAATCTACAGGCTTC -3'

Sequencing Primer
(F):5'- AATCCTGGCAGTCCCTCTGAAC -3'
(R):5'- TCTACAGGCTTCAGAGAATACATGAG -3'
Posted On 2019-10-07