Incidental Mutation 'R7421:B3gntl1'
ID575682
Institutional Source Beutler Lab
Gene Symbol B3gntl1
Ensembl Gene ENSMUSG00000046605
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7421 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location121616197-121673153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121624178 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 255 (P255T)
Ref Sequence ENSEMBL: ENSMUSP00000068590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062654] [ENSMUST00000067399]
Predicted Effect probably benign
Transcript: ENSMUST00000062654
SMART Domains Protein: ENSMUSP00000049890
Gene: ENSMUSG00000046605

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 14 244 3e-13 PFAM
Pfam:Glycos_transf_2 17 189 2.2e-24 PFAM
Pfam:Glyco_tranf_2_2 17 237 9.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067399
AA Change: P255T

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000068590
Gene: ENSMUSG00000046605
AA Change: P255T

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 14 245 1.4e-10 PFAM
Pfam:Glycos_transf_2 17 189 1.2e-23 PFAM
Pfam:Glyco_tranf_2_2 17 248 2.1e-8 PFAM
Meta Mutation Damage Score 0.1266 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T C 2: 156,555,995 I309T possibly damaging Het
Abca12 A C 1: 71,247,136 L2513* probably null Het
Abca13 G C 11: 9,510,463 V4158L probably benign Het
Acaca A G 11: 84,363,736 T1880A possibly damaging Het
Arhgap5 C T 12: 52,518,000 R585C probably benign Het
Arsk A C 13: 76,062,515 I471S possibly damaging Het
Asb7 T C 7: 66,660,120 D116G probably damaging Het
Atad2 A G 15: 58,134,926 S17P probably benign Het
Atf5 T C 7: 44,815,138 E10G probably damaging Het
Cacna1s A G 1: 136,086,802 N649S probably damaging Het
Ccnc A G 4: 21,743,291 Y192C probably damaging Het
Cd28 A G 1: 60,763,300 N126S probably benign Het
Cep57 A G 9: 13,810,673 S360P possibly damaging Het
Ces1e C T 8: 93,215,075 V257I probably benign Het
Chd1 A G 17: 15,749,398 K913R probably benign Het
Cluap1 A T 16: 3,940,793 D373V probably damaging Het
Cnmd T C 14: 79,645,507 I160V probably benign Het
Col6a4 G A 9: 106,020,795 P1686S probably damaging Het
Coro7 G T 16: 4,668,751 A186E probably benign Het
Cuta T C 17: 26,939,457 probably benign Het
Dnah2 G A 11: 69,492,805 H1098Y probably benign Het
Duox1 T A 2: 122,323,230 C345S probably damaging Het
Ephb4 T A 5: 137,354,425 I90K possibly damaging Het
Erich3 T A 3: 154,733,561 M280K probably damaging Het
Fcer2a T A 8: 3,690,335 H4L probably benign Het
Grk1 A T 8: 13,405,316 I67F probably damaging Het
Grm8 A C 6: 27,762,477 S250A possibly damaging Het
H2-Q6 A G 17: 35,425,228 E62G possibly damaging Het
Inppl1 C T 7: 101,832,937 R144H probably damaging Het
Itga3 G T 11: 95,068,855 P33Q probably benign Het
Itgax G A 7: 128,140,432 S672N probably damaging Het
Itpk1 A T 12: 102,574,065 V253E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Mrps7 T C 11: 115,604,891 V85A probably benign Het
Muc2 T C 7: 141,748,126 L427P Het
Mum1 T A 10: 80,232,753 S244T probably benign Het
Myef2 G T 2: 125,110,617 Q185K probably benign Het
Olfr1249 T A 2: 89,630,571 D109V probably damaging Het
Olfr22-ps1 G T 11: 73,955,509 C273F unknown Het
Pcdh15 G A 10: 74,454,065 M905I possibly damaging Het
Pgm5 C T 19: 24,709,299 V515M probably benign Het
Pik3r1 A G 13: 101,689,136 I381T probably damaging Het
Pla2g4f A G 2: 120,307,256 M341T probably benign Het
Prmt2 A G 10: 76,221,078 F204L probably benign Het
Rasa2 A G 9: 96,611,447 V50A unknown Het
Scn7a A C 2: 66,675,532 I1671S probably benign Het
Sco2 G A 15: 89,371,720 R244C possibly damaging Het
Slfn1 A G 11: 83,121,141 M28V possibly damaging Het
Slfn9 A T 11: 82,981,371 C846* probably null Het
Slfn9 A G 11: 82,987,736 I189T probably damaging Het
Svil T A 18: 5,056,109 S327R probably benign Het
Tcaf3 A T 6: 42,596,842 N145K probably benign Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ttc37 A T 13: 76,148,825 K1100N probably benign Het
Tusc5 G A 11: 76,694,225 R147Q unknown Het
Upp2 G T 2: 58,771,574 V130F possibly damaging Het
Vnn3 G A 10: 23,865,768 A324T probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp39 A T 11: 58,890,107 C610S probably damaging Het
Other mutations in B3gntl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:B3gntl1 APN 11 121670963 missense probably damaging 1.00
IGL01640:B3gntl1 APN 11 121673020 missense probably benign
IGL02609:B3gntl1 APN 11 121644601 splice site probably benign
R0370:B3gntl1 UTSW 11 121624154 missense probably damaging 1.00
R0394:B3gntl1 UTSW 11 121619715 missense probably damaging 1.00
R0469:B3gntl1 UTSW 11 121673025 missense probably benign
R0520:B3gntl1 UTSW 11 121623488 missense possibly damaging 0.89
R0541:B3gntl1 UTSW 11 121644604 splice site probably benign
R1460:B3gntl1 UTSW 11 121639798 missense probably damaging 1.00
R1600:B3gntl1 UTSW 11 121630836 missense probably damaging 1.00
R1961:B3gntl1 UTSW 11 121644525 critical splice donor site probably null
R4884:B3gntl1 UTSW 11 121629969 missense possibly damaging 0.83
R5779:B3gntl1 UTSW 11 121651676 splice site probably null
R7387:B3gntl1 UTSW 11 121629915 missense possibly damaging 0.87
R7506:B3gntl1 UTSW 11 121670914 missense probably damaging 1.00
R7654:B3gntl1 UTSW 11 121651613 missense probably damaging 1.00
R7715:B3gntl1 UTSW 11 121639796 missense possibly damaging 0.93
R8809:B3gntl1 UTSW 11 121630864 missense possibly damaging 0.83
Z1177:B3gntl1 UTSW 11 121639814 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGGCCAGCAGTTAGATG -3'
(R):5'- ACTTCTTGCTATGAGAGGTGGC -3'

Sequencing Primer
(F):5'- CAGCAGTTAGATGGCAGTGG -3'
(R):5'- CTTCTTGCTATGAGAGGTGGCAAAAG -3'
Posted On2019-10-07