Incidental Mutation 'R7421:Chd1'
ID575694
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7421 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15749398 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 913 (K913R)
Ref Sequence ENSEMBL: ENSMUSP00000024627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
Predicted Effect probably benign
Transcript: ENSMUST00000024627
AA Change: K913R

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: K913R

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173311
AA Change: K913R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: K913R

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000134718
Gene: ENSMUSG00000023852
AA Change: K297R

DomainStartEndE-ValueType
Pfam:SNF2_N 1 148 3.6e-34 PFAM
low complexity region 172 184 N/A INTRINSIC
HELICc 201 285 8.48e-25 SMART
Blast:DEXDc 340 516 1e-47 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T C 2: 156,555,995 I309T possibly damaging Het
Abca12 A C 1: 71,247,136 L2513* probably null Het
Abca13 G C 11: 9,510,463 V4158L probably benign Het
Acaca A G 11: 84,363,736 T1880A possibly damaging Het
Arhgap5 C T 12: 52,518,000 R585C probably benign Het
Arsk A C 13: 76,062,515 I471S possibly damaging Het
Asb7 T C 7: 66,660,120 D116G probably damaging Het
Atad2 A G 15: 58,134,926 S17P probably benign Het
Atf5 T C 7: 44,815,138 E10G probably damaging Het
B3gntl1 G T 11: 121,624,178 P255T probably benign Het
Cacna1s A G 1: 136,086,802 N649S probably damaging Het
Ccnc A G 4: 21,743,291 Y192C probably damaging Het
Cd28 A G 1: 60,763,300 N126S probably benign Het
Cep57 A G 9: 13,810,673 S360P possibly damaging Het
Ces1e C T 8: 93,215,075 V257I probably benign Het
Cluap1 A T 16: 3,940,793 D373V probably damaging Het
Cnmd T C 14: 79,645,507 I160V probably benign Het
Col6a4 G A 9: 106,020,795 P1686S probably damaging Het
Coro7 G T 16: 4,668,751 A186E probably benign Het
Cuta T C 17: 26,939,457 probably benign Het
Dnah2 G A 11: 69,492,805 H1098Y probably benign Het
Duox1 T A 2: 122,323,230 C345S probably damaging Het
Ephb4 T A 5: 137,354,425 I90K possibly damaging Het
Erich3 T A 3: 154,733,561 M280K probably damaging Het
Fcer2a T A 8: 3,690,335 H4L probably benign Het
Grk1 A T 8: 13,405,316 I67F probably damaging Het
Grm8 A C 6: 27,762,477 S250A possibly damaging Het
H2-Q6 A G 17: 35,425,228 E62G possibly damaging Het
Inppl1 C T 7: 101,832,937 R144H probably damaging Het
Itga3 G T 11: 95,068,855 P33Q probably benign Het
Itgax G A 7: 128,140,432 S672N probably damaging Het
Itpk1 A T 12: 102,574,065 V253E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Mrps7 T C 11: 115,604,891 V85A probably benign Het
Muc2 T C 7: 141,748,126 L427P Het
Mum1 T A 10: 80,232,753 S244T probably benign Het
Myef2 G T 2: 125,110,617 Q185K probably benign Het
Olfr1249 T A 2: 89,630,571 D109V probably damaging Het
Olfr22-ps1 G T 11: 73,955,509 C273F unknown Het
Pcdh15 G A 10: 74,454,065 M905I possibly damaging Het
Pgm5 C T 19: 24,709,299 V515M probably benign Het
Pik3r1 A G 13: 101,689,136 I381T probably damaging Het
Pla2g4f A G 2: 120,307,256 M341T probably benign Het
Prmt2 A G 10: 76,221,078 F204L probably benign Het
Rasa2 A G 9: 96,611,447 V50A unknown Het
Scn7a A C 2: 66,675,532 I1671S probably benign Het
Sco2 G A 15: 89,371,720 R244C possibly damaging Het
Slfn1 A G 11: 83,121,141 M28V possibly damaging Het
Slfn9 A T 11: 82,981,371 C846* probably null Het
Slfn9 A G 11: 82,987,736 I189T probably damaging Het
Svil T A 18: 5,056,109 S327R probably benign Het
Tcaf3 A T 6: 42,596,842 N145K probably benign Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ttc37 A T 13: 76,148,825 K1100N probably benign Het
Tusc5 G A 11: 76,694,225 R147Q unknown Het
Upp2 G T 2: 58,771,574 V130F possibly damaging Het
Vnn3 G A 10: 23,865,768 A324T probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp39 A T 11: 58,890,107 C610S probably damaging Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
Holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 splice site probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7230:Chd1 UTSW 17 15706937 splice site probably null
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
R7704:Chd1 UTSW 17 15767475 missense probably benign
R7763:Chd1 UTSW 17 15733041 missense probably damaging 1.00
R8156:Chd1 UTSW 17 15761404 missense probably benign
R8194:Chd1 UTSW 17 17374475 start gained probably benign
R8261:Chd1 UTSW 17 17387542 missense probably benign 0.02
R8338:Chd1 UTSW 17 15769980 missense probably damaging 1.00
R8401:Chd1 UTSW 17 15743211 missense probably damaging 1.00
R8411:Chd1 UTSW 17 15762449 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15766347 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15768733 missense probably damaging 1.00
Z1177:Chd1 UTSW 17 15747801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATGTGGTTACCAAGTTCG -3'
(R):5'- TACCTGTGTGTATGCCTCTAAC -3'

Sequencing Primer
(F):5'- GTGGTTACCAAGTTCGATATTTTTG -3'
(R):5'- GCACAGTGCAATTTATTTACCTGGG -3'
Posted On2019-10-07