Incidental Mutation 'R7422:Atp9a'
ID575711
Institutional Source Beutler Lab
Gene Symbol Atp9a
Ensembl Gene ENSMUSG00000027546
Gene NameATPase, class II, type 9A
SynonymsClass II, IIa
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7422 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location168634438-168742409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 168648593 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 829 (L829Q)
Ref Sequence ENSEMBL: ENSMUSP00000104805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029060] [ENSMUST00000109175] [ENSMUST00000109176] [ENSMUST00000109177] [ENSMUST00000178504]
Predicted Effect probably damaging
Transcript: ENSMUST00000029060
AA Change: L771Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029060
Gene: ENSMUSG00000027546
AA Change: L771Q

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109175
AA Change: L755Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104804
Gene: ENSMUSG00000027546
AA Change: L755Q

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
Pfam:E1-E2_ATPase 92 352 7.2e-21 PFAM
Pfam:Hydrolase 369 781 1.4e-19 PFAM
Pfam:HAD 372 778 1.1e-14 PFAM
Pfam:Hydrolase_like2 448 563 3.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109176
AA Change: L829Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104805
Gene: ENSMUSG00000027546
AA Change: L829Q

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 97 163 1.9e-20 PFAM
Pfam:E1-E2_ATPase 166 418 5.8e-13 PFAM
Pfam:Hydrolase 443 855 2.8e-13 PFAM
Pfam:HAD 446 852 2.4e-14 PFAM
Pfam:Cation_ATPase 522 635 1.5e-6 PFAM
Pfam:PhoLip_ATPase_C 869 1098 1.7e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109177
AA Change: L753Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104806
Gene: ENSMUSG00000027546
AA Change: L753Q

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Pfam:E1-E2_ATPase 90 350 7.2e-21 PFAM
Pfam:Hydrolase 367 779 1.4e-19 PFAM
Pfam:HAD 370 776 1.1e-14 PFAM
Pfam:Hydrolase_like2 446 561 3.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178504
AA Change: L771Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136793
Gene: ENSMUSG00000027546
AA Change: L771Q

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (98/101)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,881,059 C456S probably damaging Het
4930524J08Rik T C 5: 99,979,209 probably benign Het
Adam28 T G 14: 68,626,877 R492S probably damaging Het
Adarb2 G A 13: 8,757,277 A705T possibly damaging Het
Adprhl1 T C 8: 13,222,873 D1295G probably benign Het
Aldh3b3 A G 19: 3,966,476 I365V probably benign Het
Aldh8a1 T C 10: 21,389,097 F208L possibly damaging Het
Ap3b1 G A 13: 94,528,165 V871I unknown Het
Apol7e A T 15: 77,714,352 R6* probably null Het
Arfgap3 T C 15: 83,306,949 E456G probably damaging Het
Arhgef1 T C 7: 24,916,036 L285P probably benign Het
Arhgef7 T A 8: 11,800,861 C315S probably benign Het
Babam2 T A 5: 31,731,049 probably null Het
Bptf C T 11: 107,060,558 R2185H probably damaging Het
Brd9 A C 13: 73,954,578 M473L probably benign Het
C7 T C 15: 5,012,056 H456R probably benign Het
Cabp7 C A 11: 4,738,856 A205S probably damaging Het
Catsperb A G 12: 101,588,034 I662M probably damaging Het
Ccl21a T C 4: 42,773,906 M5V probably benign Het
Cdyl G T 13: 35,858,194 R405L possibly damaging Het
Cep89 T C 7: 35,428,247 L538P probably damaging Het
Cercam A G 2: 29,872,880 M209V possibly damaging Het
Chfr T A 5: 110,162,705 probably null Het
Cntnap5c T A 17: 58,410,231 Y1269* probably null Het
Col6a2 G T 10: 76,603,336 C833* probably null Het
Cpeb3 T A 19: 37,174,500 I159F probably benign Het
Cplx2 G A 13: 54,378,850 E24K possibly damaging Het
Ctsb A G 14: 63,142,303 T332A probably benign Het
Cyp2j12 T A 4: 96,140,985 T20S probably benign Het
Dcst2 T A 3: 89,366,686 H181Q probably damaging Het
Dnm1l T C 16: 16,318,474 I411V probably benign Het
Dock5 T A 14: 67,809,030 I768F probably benign Het
Dpcr1 T A 17: 35,638,420 T96S probably benign Het
Ecel1 A G 1: 87,149,612 Y625H probably damaging Het
Efl1 T G 7: 82,681,379 S253R probably damaging Het
Elmod1 T A 9: 53,912,843 D287V probably damaging Het
Fam171a2 T C 11: 102,438,665 S423G probably benign Het
Fbxo8 A T 8: 56,569,282 probably null Het
Flnc G T 6: 29,455,471 G2040W probably damaging Het
Fras1 C T 5: 96,673,599 A1405V probably benign Het
Frem3 A C 8: 80,615,763 I1562L probably benign Het
Fxr1 C T 3: 34,049,220 A233V probably damaging Het
Helb A G 10: 120,108,894 F246L probably damaging Het
Hils1 A G 11: 94,968,358 R160G possibly damaging Het
Hoxb6 G T 11: 96,292,684 probably benign Het
Hspa2 A G 12: 76,406,110 E526G probably damaging Het
Hyal5 A T 6: 24,875,984 probably benign Het
Ints6 A T 14: 62,704,775 V503E probably benign Het
Ints9 C T 14: 65,032,298 T479I possibly damaging Het
Jag1 C T 2: 137,085,055 R928H probably benign Het
Lman2 A T 13: 55,351,525 I179N probably damaging Het
Lta T C 17: 35,203,829 S173G probably benign Het
Mki67 G A 7: 135,698,370 P1645L probably damaging Het
Mrc2 A T 11: 105,292,783 probably benign Het
Muc4 T A 16: 32,754,689 M1521K probably benign Het
Mylk3 T G 8: 85,355,244 D438A probably benign Het
Myo7a T A 7: 98,051,626 probably null Het
Nsmce4a G T 7: 130,533,817 Q342K probably benign Het
Olfr1232 T A 2: 89,326,079 I34F probably benign Het
Olfr455 A G 6: 42,538,119 I301T possibly damaging Het
Olfr484 A G 7: 108,124,861 L134P probably damaging Het
Olfr808 A T 10: 129,768,267 Y257F possibly damaging Het
Osbpl6 T A 2: 76,593,386 F864L probably damaging Het
Pla2g4a A G 1: 149,932,687 S2P probably benign Het
Plce1 T C 19: 38,651,885 L525P probably damaging Het
Por A T 5: 135,734,919 M667L probably benign Het
Psma4 T C 9: 54,954,882 Y97H probably benign Het
Qtrt1 A T 9: 21,412,457 H126L probably benign Het
Rab3a A T 8: 70,756,523 Y102F possibly damaging Het
Rnf212 T A 5: 108,731,689 H87L probably benign Het
Rnf216 A G 5: 143,090,836 S98P probably benign Het
Ryr1 G T 7: 29,085,870 R1806S probably benign Het
Scgb1b3 A T 7: 31,375,837 L37F probably benign Het
Sds T C 5: 120,479,189 S37P probably damaging Het
Senp6 A G 9: 80,113,877 R280G probably damaging Het
She T A 3: 89,854,557 I441K possibly damaging Het
Slc6a20b A G 9: 123,607,617 S244P possibly damaging Het
Slc9a3 A T 13: 74,150,885 Y141F probably damaging Het
Slco6c1 A T 1: 97,081,482 H426Q probably benign Het
Smc2 C A 4: 52,440,301 Q16K probably benign Het
Sphkap A C 1: 83,263,826 V1535G probably benign Het
Stard9 C A 2: 120,702,152 N2963K probably benign Het
Sycp2 C T 2: 178,394,151 A248T probably damaging Het
Taar8a T C 10: 24,076,864 L122P probably damaging Het
Tab1 T A 15: 80,160,244 V491E probably benign Het
Tanc1 T C 2: 59,806,344 M857T probably benign Het
Tcirg1 C A 19: 3,899,008 R427L possibly damaging Het
Tmem109 A C 19: 10,871,760 *244G probably null Het
Tox2 A G 2: 163,321,515 Y136C Het
Tubb1 T C 2: 174,457,032 V169A possibly damaging Het
Ubr3 T C 2: 69,953,542 probably null Het
Vmn1r225 T A 17: 20,502,797 F167I probably benign Het
Vmn2r65 A C 7: 84,946,361 W372G probably damaging Het
Vps13a A T 19: 16,750,173 D188E probably damaging Het
Vsnl1 G T 12: 11,326,438 Q149K probably benign Het
Wdr35 A G 12: 9,004,105 N466S probably benign Het
Ywhae T A 11: 75,759,343 S210R probably damaging Het
Zfp28 T A 7: 6,394,749 S728T probably damaging Het
Zfpm1 A G 8: 122,336,959 D919G unknown Het
Other mutations in Atp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Atp9a APN 2 168640680 missense probably benign 0.24
IGL01594:Atp9a APN 2 168691012 missense probably damaging 1.00
IGL01911:Atp9a APN 2 168653561 missense probably damaging 1.00
IGL02606:Atp9a APN 2 168652668 missense probably damaging 1.00
IGL02639:Atp9a APN 2 168649620 missense probably damaging 1.00
IGL03011:Atp9a APN 2 168652632 missense probably damaging 1.00
IGL03294:Atp9a APN 2 168689305 missense probably benign 0.04
IGL03310:Atp9a APN 2 168639959 missense probably damaging 1.00
R0114:Atp9a UTSW 2 168710856 nonsense probably null
R0194:Atp9a UTSW 2 168643885 missense probably benign 0.00
R0427:Atp9a UTSW 2 168640697 critical splice acceptor site probably null
R0508:Atp9a UTSW 2 168649526 splice site probably null
R1611:Atp9a UTSW 2 168673569 missense probably damaging 1.00
R2120:Atp9a UTSW 2 168653537 missense probably damaging 1.00
R2330:Atp9a UTSW 2 168639929 missense probably benign 0.01
R2348:Atp9a UTSW 2 168710826 splice site probably benign
R2404:Atp9a UTSW 2 168675363 critical splice acceptor site probably null
R2881:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R2882:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R4029:Atp9a UTSW 2 168689325 missense probably damaging 1.00
R4371:Atp9a UTSW 2 168649615 missense probably damaging 1.00
R4411:Atp9a UTSW 2 168661933 missense probably damaging 1.00
R4446:Atp9a UTSW 2 168681997 missense possibly damaging 0.75
R4583:Atp9a UTSW 2 168689360 splice site probably null
R4626:Atp9a UTSW 2 168639943 missense probably damaging 1.00
R4661:Atp9a UTSW 2 168637672 missense possibly damaging 0.52
R4679:Atp9a UTSW 2 168661964 missense possibly damaging 0.95
R4738:Atp9a UTSW 2 168668181 missense probably benign
R5191:Atp9a UTSW 2 168662063 missense possibly damaging 0.51
R5216:Atp9a UTSW 2 168674888 missense probably benign 0.38
R5280:Atp9a UTSW 2 168639988 missense possibly damaging 0.66
R5509:Atp9a UTSW 2 168639937 missense probably damaging 1.00
R5798:Atp9a UTSW 2 168690964 critical splice donor site probably null
R5807:Atp9a UTSW 2 168653534 missense probably damaging 0.98
R5926:Atp9a UTSW 2 168706271 missense probably damaging 1.00
R6046:Atp9a UTSW 2 168634870 missense probably benign 0.42
R6244:Atp9a UTSW 2 168689352 critical splice acceptor site probably null
R6307:Atp9a UTSW 2 168668170 missense probably benign 0.02
R6345:Atp9a UTSW 2 168676173 missense probably damaging 0.99
R6442:Atp9a UTSW 2 168649561 missense probably benign 0.01
R6459:Atp9a UTSW 2 168668013 missense probably damaging 1.00
R6769:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6771:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6841:Atp9a UTSW 2 168654220 missense possibly damaging 0.87
R7271:Atp9a UTSW 2 168734127
R7490:Atp9a UTSW 2 168675352 missense probably benign 0.00
R7827:Atp9a UTSW 2 168705194 missense probably benign 0.03
R7833:Atp9a UTSW 2 168674857 missense probably benign 0.02
R7854:Atp9a UTSW 2 168648603 missense probably benign 0.02
R7916:Atp9a UTSW 2 168674857 missense probably benign 0.02
R7937:Atp9a UTSW 2 168648603 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCACAGCAGCAGAACTCAGG -3'
(R):5'- CTGAGCACTTAGGCTATGGG -3'

Sequencing Primer
(F):5'- ACTCAGGCTCCTTGTGAAAAG -3'
(R):5'- AGGCTATGGGCTGCAGG -3'
Posted On2019-10-07