Incidental Mutation 'R7422:Tubb1'
ID575712
Institutional Source Beutler Lab
Gene Symbol Tubb1
Ensembl Gene ENSMUSG00000016255
Gene Nametubulin, beta 1 class VI
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R7422 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location174450695-174457882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174457032 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 169 (V169A)
Ref Sequence ENSEMBL: ENSMUSP00000016399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016396] [ENSMUST00000016399]
Predicted Effect probably benign
Transcript: ENSMUST00000016396
SMART Domains Protein: ENSMUSP00000016396
Gene: ENSMUSG00000016252

DomainStartEndE-ValueType
Pfam:ATP-synt_Eps 2 51 7.8e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000016399
AA Change: V169A

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000016399
Gene: ENSMUSG00000016255
AA Change: V169A

DomainStartEndE-ValueType
Tubulin 47 244 3.42e-68 SMART
Tubulin_C 246 383 1.84e-41 SMART
low complexity region 433 448 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes have thrombocytopenia resulting from a defect in generating proplatelets. The platelets that are produced have structural and functional defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,881,059 C456S probably damaging Het
4930524J08Rik T C 5: 99,979,209 probably benign Het
Adam28 T G 14: 68,626,877 R492S probably damaging Het
Adarb2 G A 13: 8,757,277 A705T possibly damaging Het
Adprhl1 T C 8: 13,222,873 D1295G probably benign Het
Aldh3b3 A G 19: 3,966,476 I365V probably benign Het
Aldh8a1 T C 10: 21,389,097 F208L possibly damaging Het
Ap3b1 G A 13: 94,528,165 V871I unknown Het
Apol7e A T 15: 77,714,352 R6* probably null Het
Arfgap3 T C 15: 83,306,949 E456G probably damaging Het
Arhgef1 T C 7: 24,916,036 L285P probably benign Het
Arhgef7 T A 8: 11,800,861 C315S probably benign Het
Atp9a A T 2: 168,648,593 L829Q probably damaging Het
Babam2 T A 5: 31,731,049 probably null Het
Bptf C T 11: 107,060,558 R2185H probably damaging Het
Brd9 A C 13: 73,954,578 M473L probably benign Het
C7 T C 15: 5,012,056 H456R probably benign Het
Cabp7 C A 11: 4,738,856 A205S probably damaging Het
Catsperb A G 12: 101,588,034 I662M probably damaging Het
Ccl21a T C 4: 42,773,906 M5V probably benign Het
Cdyl G T 13: 35,858,194 R405L possibly damaging Het
Cep89 T C 7: 35,428,247 L538P probably damaging Het
Cercam A G 2: 29,872,880 M209V possibly damaging Het
Chfr T A 5: 110,162,705 probably null Het
Cntnap5c T A 17: 58,410,231 Y1269* probably null Het
Col6a2 G T 10: 76,603,336 C833* probably null Het
Cpeb3 T A 19: 37,174,500 I159F probably benign Het
Cplx2 G A 13: 54,378,850 E24K possibly damaging Het
Ctsb A G 14: 63,142,303 T332A probably benign Het
Cyp2j12 T A 4: 96,140,985 T20S probably benign Het
Dcst2 T A 3: 89,366,686 H181Q probably damaging Het
Dnm1l T C 16: 16,318,474 I411V probably benign Het
Dock5 T A 14: 67,809,030 I768F probably benign Het
Dpcr1 T A 17: 35,638,420 T96S probably benign Het
Ecel1 A G 1: 87,149,612 Y625H probably damaging Het
Efl1 T G 7: 82,681,379 S253R probably damaging Het
Elmod1 T A 9: 53,912,843 D287V probably damaging Het
Fam171a2 T C 11: 102,438,665 S423G probably benign Het
Fbxo8 A T 8: 56,569,282 probably null Het
Flnc G T 6: 29,455,471 G2040W probably damaging Het
Fras1 C T 5: 96,673,599 A1405V probably benign Het
Frem3 A C 8: 80,615,763 I1562L probably benign Het
Fxr1 C T 3: 34,049,220 A233V probably damaging Het
Helb A G 10: 120,108,894 F246L probably damaging Het
Hils1 A G 11: 94,968,358 R160G possibly damaging Het
Hoxb6 G T 11: 96,292,684 probably benign Het
Hspa2 A G 12: 76,406,110 E526G probably damaging Het
Hyal5 A T 6: 24,875,984 probably benign Het
Ints6 A T 14: 62,704,775 V503E probably benign Het
Ints9 C T 14: 65,032,298 T479I possibly damaging Het
Jag1 C T 2: 137,085,055 R928H probably benign Het
Lman2 A T 13: 55,351,525 I179N probably damaging Het
Lta T C 17: 35,203,829 S173G probably benign Het
Mki67 G A 7: 135,698,370 P1645L probably damaging Het
Mrc2 A T 11: 105,292,783 probably benign Het
Muc4 T A 16: 32,754,689 M1521K probably benign Het
Mylk3 T G 8: 85,355,244 D438A probably benign Het
Myo7a T A 7: 98,051,626 probably null Het
Nsmce4a G T 7: 130,533,817 Q342K probably benign Het
Olfr1232 T A 2: 89,326,079 I34F probably benign Het
Olfr455 A G 6: 42,538,119 I301T possibly damaging Het
Olfr484 A G 7: 108,124,861 L134P probably damaging Het
Olfr808 A T 10: 129,768,267 Y257F possibly damaging Het
Osbpl6 T A 2: 76,593,386 F864L probably damaging Het
Pla2g4a A G 1: 149,932,687 S2P probably benign Het
Plce1 T C 19: 38,651,885 L525P probably damaging Het
Por A T 5: 135,734,919 M667L probably benign Het
Psma4 T C 9: 54,954,882 Y97H probably benign Het
Qtrt1 A T 9: 21,412,457 H126L probably benign Het
Rab3a A T 8: 70,756,523 Y102F possibly damaging Het
Rnf212 T A 5: 108,731,689 H87L probably benign Het
Rnf216 A G 5: 143,090,836 S98P probably benign Het
Ryr1 G T 7: 29,085,870 R1806S probably benign Het
Scgb1b3 A T 7: 31,375,837 L37F probably benign Het
Sds T C 5: 120,479,189 S37P probably damaging Het
Senp6 A G 9: 80,113,877 R280G probably damaging Het
She T A 3: 89,854,557 I441K possibly damaging Het
Slc6a20b A G 9: 123,607,617 S244P possibly damaging Het
Slc9a3 A T 13: 74,150,885 Y141F probably damaging Het
Slco6c1 A T 1: 97,081,482 H426Q probably benign Het
Smc2 C A 4: 52,440,301 Q16K probably benign Het
Sphkap A C 1: 83,263,826 V1535G probably benign Het
Stard9 C A 2: 120,702,152 N2963K probably benign Het
Sycp2 C T 2: 178,394,151 A248T probably damaging Het
Taar8a T C 10: 24,076,864 L122P probably damaging Het
Tab1 T A 15: 80,160,244 V491E probably benign Het
Tanc1 T C 2: 59,806,344 M857T probably benign Het
Tcirg1 C A 19: 3,899,008 R427L possibly damaging Het
Tmem109 A C 19: 10,871,760 *244G probably null Het
Tox2 A G 2: 163,321,515 Y136C Het
Ubr3 T C 2: 69,953,542 probably null Het
Vmn1r225 T A 17: 20,502,797 F167I probably benign Het
Vmn2r65 A C 7: 84,946,361 W372G probably damaging Het
Vps13a A T 19: 16,750,173 D188E probably damaging Het
Vsnl1 G T 12: 11,326,438 Q149K probably benign Het
Wdr35 A G 12: 9,004,105 N466S probably benign Het
Ywhae T A 11: 75,759,343 S210R probably damaging Het
Zfp28 T A 7: 6,394,749 S728T probably damaging Het
Zfpm1 A G 8: 122,336,959 D919G unknown Het
Other mutations in Tubb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Tubb1 APN 2 174456898 missense possibly damaging 0.87
IGL02534:Tubb1 APN 2 174455669 missense probably benign 0.04
IGL02535:Tubb1 APN 2 174457566 missense probably benign 0.00
IGL03404:Tubb1 APN 2 174457448 missense probably damaging 1.00
R0117:Tubb1 UTSW 2 174457784 missense probably benign 0.00
R0666:Tubb1 UTSW 2 174457755 missense probably damaging 0.98
R0939:Tubb1 UTSW 2 174455756 missense probably damaging 1.00
R1163:Tubb1 UTSW 2 174457739 missense probably benign
R1317:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1458:Tubb1 UTSW 2 174450803 critical splice donor site probably null
R1574:Tubb1 UTSW 2 174457422 missense probably benign
R1574:Tubb1 UTSW 2 174457422 missense probably benign
R1658:Tubb1 UTSW 2 174456623 missense probably damaging 1.00
R1751:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1761:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1869:Tubb1 UTSW 2 174456689 missense probably benign 0.00
R1969:Tubb1 UTSW 2 174455691 missense possibly damaging 0.92
R2412:Tubb1 UTSW 2 174457110 missense possibly damaging 0.71
R4249:Tubb1 UTSW 2 174455733 missense probably null 0.93
R4415:Tubb1 UTSW 2 174457673 missense probably benign 0.12
R5154:Tubb1 UTSW 2 174456864 missense probably benign 0.19
R5276:Tubb1 UTSW 2 174457424 missense probably damaging 0.97
R5730:Tubb1 UTSW 2 174457769 missense probably benign
R6008:Tubb1 UTSW 2 174457774 missense probably benign 0.00
R6719:Tubb1 UTSW 2 174457394 missense probably damaging 1.00
X0063:Tubb1 UTSW 2 174457295 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGATCGAAAATGTCATGGATG -3'
(R):5'- ATTGAGCTGACCGGGAAAGC -3'

Sequencing Primer
(F):5'- TCGAAAATGTCATGGATGTGGTAAG -3'
(R):5'- TGATTCCGCTCATGGTCAAGGAC -3'
Posted On2019-10-07