Mutagenetix > Incidental Mutation

Incidental Mutation 'R0627:Trip12'

57574

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

038816-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0627 (G1)

Quality Score

161

Status

Validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 84768597 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 487 (V487F)

Ref Sequence

ENSEMBL: ENSMUSP00000140267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894]

AlphaFold

G5E870

Predicted Effect

probably damaging
Transcript: ENSMUST00000027421
AA Change: V487F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: V487F

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185672

Predicted Effect

probably benign
Transcript: ENSMUST00000185909

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186465
AA Change: V487F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: V487F

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186648
AA Change: V481F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: V481F

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186894
AA Change: V487F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: V487F

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	3e-20	SMART
PDB:1WA5\|B	447	641	7e-6	PDB
Blast:ARM	476	516	6e-6	BLAST
WWE	764	839	6.9e-25	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000190464
AA Change: V167F

Meta Mutation Damage Score

0.2389

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.2%
20x: 94.2%

Validation Efficiency

99% (111/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	G	1: 26,685,889	M70T	probably benign	Het
Adm2	T	A	15: 89,324,305	Y149*	probably null	Het
Ahi1	G	A	10: 20,965,522	R236H	probably benign	Het
Armcx4	A	G	X: 134,695,823	N2160S	possibly damaging	Het
Asns	A	T	6: 7,675,516	D495E	probably benign	Het
Bcl9	A	G	3: 97,205,473	V1222A	probably damaging	Het
Cd46	A	T	1: 195,092,186	C14S	probably benign	Het
Cdk11b	T	A	4: 155,640,772		probably benign	Het
Cdkl3	T	C	11: 52,011,308	Y115H	probably damaging	Het
Cep41	C	A	6: 30,656,631	C274F	probably damaging	Het
Ces1a	C	A	8: 93,042,043	V108F	probably benign	Het
Clca4b	A	G	3: 144,928,259	Y132H	probably benign	Het
Col5a3	T	C	9: 20,775,485	E1323G	unknown	Het
Cttnbp2	A	G	6: 18,367,373	*1139Q	probably null	Het
Cyp2d9	T	A	15: 82,455,790	I127N	probably damaging	Het
Dennd1b	A	G	1: 139,081,219	Y220C	probably damaging	Het
Desi2	T	C	1: 178,249,352	S141P	possibly damaging	Het
Dgcr2	A	G	16: 17,844,008	S453P	probably damaging	Het
Dnah3	A	G	7: 120,020,915	L1586P	probably damaging	Het
Dpep3	T	C	8: 105,978,731	D129G	possibly damaging	Het
Eci3	C	T	13: 34,948,143	V241I	possibly damaging	Het
Ecm2	A	T	13: 49,521,083		probably benign	Het
Emilin3	A	G	2: 160,908,176	L551P	probably damaging	Het
Erap1	A	C	13: 74,675,814		probably benign	Het
Ern1	T	C	11: 106,398,693	D928G	probably benign	Het
Fam214b	G	T	4: 43,036,242	P163Q	probably damaging	Het
Fancc	C	A	13: 63,317,478	A472S	probably damaging	Het
Fkbp7	A	T	2: 76,672,844	D57E	probably damaging	Het
Gabbr2	T	A	4: 46,681,223	I703F	possibly damaging	Het
Gabrg3	A	T	7: 56,724,595	C408S	probably damaging	Het
Gm13119	C	A	4: 144,362,846	L245I	probably benign	Het
Gm13757	A	G	2: 88,446,219	S240P	probably damaging	Het
Gm8674	T	C	13: 49,899,715		noncoding transcript	Het
Gnas	G	A	2: 174,298,135		probably benign	Het
Grhl3	A	G	4: 135,552,681	V354A	probably benign	Het
Gsdme	G	T	6: 50,229,279		probably benign	Het
H2-D1	A	G	17: 35,265,922	E253G	probably damaging	Het
Habp2	A	G	19: 56,314,046	T31A	probably damaging	Het
Ifrd1	A	G	12: 40,206,987		probably null	Het
Il20	A	G	1: 130,909,739		probably benign	Het
Isx	A	T	8: 74,892,700	I160F	possibly damaging	Het
Itgb2l	T	G	16: 96,422,911		probably benign	Het
Kcnv1	T	G	15: 45,112,881		probably benign	Het
Kif17	T	C	4: 138,288,487		probably null	Het
Kirrel3	A	C	9: 35,035,174	D743A	probably damaging	Het
Lmod3	T	C	6: 97,248,071	D263G	probably damaging	Het
Manf	A	G	9: 106,889,186	L132P	probably damaging	Het
Mark2	C	T	19: 7,281,960		probably null	Het
Med10	G	A	13: 69,815,601	S107N	possibly damaging	Het
Med31	A	G	11: 72,213,775		probably null	Het
Mki67	C	A	7: 135,708,258	A155S	probably benign	Het
Mprip	T	A	11: 59,769,972	L2193Q	probably damaging	Het
Mylk	A	G	16: 35,000,429	N126S	probably damaging	Het
Myo16	A	G	8: 10,439,689	I715V	probably benign	Het
Myo18b	T	C	5: 112,798,834	T1591A	probably benign	Het
Myt1	T	A	2: 181,795,689	D64E	probably benign	Het
Ndufa10	A	T	1: 92,469,896	Y61N	probably damaging	Het
Nob1	A	G	8: 107,416,224	F275S	probably damaging	Het
Nop2	T	C	6: 125,139,704	V333A	possibly damaging	Het
Ogdh	T	A	11: 6,347,216	V545D	possibly damaging	Het
Olfr1101	T	C	2: 86,989,014	N54S	probably benign	Het
Olfr1461	A	G	19: 13,165,250	T79A	probably benign	Het
Olfr213	T	A	6: 116,540,988	N178K	possibly damaging	Het
Olfr364-ps1	T	G	2: 37,146,330	N39K	probably damaging	Het
Olfr430	G	T	1: 174,070,077	V260F	probably damaging	Het
Olfr826	A	G	10: 130,180,688	F64S	probably damaging	Het
Pcdhb1	T	C	18: 37,265,721	F242L	probably damaging	Het
Pkd2l2	A	G	18: 34,425,102	Y278C	probably damaging	Het
Plxdc1	T	A	11: 97,932,204		probably null	Het
Ppp2r5b	A	G	19: 6,232,634		probably benign	Het
Prelid2	T	A	18: 41,937,652	T39S	possibly damaging	Het
Prkd1	A	T	12: 50,490,041	F87I	probably benign	Het
Prl3d3	C	T	13: 27,156,847	T4I	probably damaging	Het
Proser3	T	A	7: 30,540,783	T299S	probably benign	Het
Ptprc	G	T	1: 138,068,320	H1095N	probably damaging	Het
Rab11fip5	G	T	6: 85,348,051	P425T	probably benign	Het
Rac2	T	C	15: 78,564,968	T115A	probably damaging	Het
Rtl9	C	A	X: 143,101,275	T561K	possibly damaging	Het
Runx2	T	C	17: 44,658,505		probably benign	Het
Rxfp1	C	T	3: 79,648,211	V613I	probably benign	Het
Scn9a	T	C	2: 66,537,377	K656R	probably benign	Het
Sec31b	A	G	19: 44,525,607	S406P	probably benign	Het
Sept5	T	C	16: 18,625,365	D44G	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc35c2	T	C	2: 165,282,136	T94A	possibly damaging	Het
Slc8a3	T	A	12: 81,314,842	D401V	probably damaging	Het
Slitrk1	A	T	14: 108,912,239	C347S	probably damaging	Het
Smg1	G	T	7: 118,167,861		probably benign	Het
Snx14	T	C	9: 88,394,430	K610E	probably benign	Het
Sppl2a	A	G	2: 126,920,417		probably benign	Het
Stk-ps2	T	A	1: 46,029,691		noncoding transcript	Het
Sult3a1	T	C	10: 33,864,014	M23T	probably benign	Het
Syt5	A	G	7: 4,545,683	L50P	possibly damaging	Het
Tacr1	A	G	6: 82,555,031	I303V	possibly damaging	Het
Vcp	A	G	4: 42,983,011	S612P	possibly damaging	Het
Vmn1r47	A	G	6: 90,022,806	I307V	probably null	Het
Vmn1r83	T	G	7: 12,321,992	D46A	probably damaging	Het
Vmn2r118	G	T	17: 55,610,772	Q247K	probably benign	Het
Vmn2r94	C	T	17: 18,257,165	C328Y	probably damaging	Het
Vps13b	T	A	15: 35,371,999	Y13*	probably null	Het
Vps13d	C	T	4: 145,087,184	R3241H	probably damaging	Het
Wdr5b	A	G	16: 36,042,470	T320A	probably benign	Het
Zfhx2	A	T	14: 55,065,327	D1733E	probably benign	Het
Zfp541	A	G	7: 16,095,682		probably benign	Het
Zfp708	A	T	13: 67,070,717	Y314*	probably null	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGGCCATCTCATGTACTTCCTTAACT -3'
(R):5'- TCTTTTCTCTTGAAGGTTCTAAGGCCCA -3'

Sequencing Primer
(F):5'- TCAAAGCATCACTAATGGGCTG -3'
(R):5'- AGCAGCTTCTTCAAGGACTAC -3'

Posted On

2013-07-11