Incidental Mutation 'R0627:Trip12'
ID57574
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Namethyroid hormone receptor interactor 12
Synonyms6720416K24Rik, 1110036I07Rik, Gtl6
MMRRC Submission 038816-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0627 (G1)
Quality Score161
Status Validated
Chromosome1
Chromosomal Location84721189-84840516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84768597 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 487 (V487F)
Ref Sequence ENSEMBL: ENSMUSP00000140267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894]
Predicted Effect probably damaging
Transcript: ENSMUST00000027421
AA Change: V487F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: V487F

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185672
Predicted Effect probably benign
Transcript: ENSMUST00000185909
SMART Domains Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186465
AA Change: V487F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: V487F

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186648
AA Change: V481F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: V481F

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186894
AA Change: V487F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: V487F

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 3e-20 SMART
PDB:1WA5|B 447 641 7e-6 PDB
Blast:ARM 476 516 6e-6 BLAST
WWE 764 839 6.9e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000190464
AA Change: V167F
Meta Mutation Damage Score 0.2389 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.2%
Validation Efficiency 99% (111/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A G 1: 26,685,889 M70T probably benign Het
Adm2 T A 15: 89,324,305 Y149* probably null Het
Ahi1 G A 10: 20,965,522 R236H probably benign Het
Armcx4 A G X: 134,695,823 N2160S possibly damaging Het
Asns A T 6: 7,675,516 D495E probably benign Het
Bcl9 A G 3: 97,205,473 V1222A probably damaging Het
Cd46 A T 1: 195,092,186 C14S probably benign Het
Cdk11b T A 4: 155,640,772 probably benign Het
Cdkl3 T C 11: 52,011,308 Y115H probably damaging Het
Cep41 C A 6: 30,656,631 C274F probably damaging Het
Ces1a C A 8: 93,042,043 V108F probably benign Het
Clca4b A G 3: 144,928,259 Y132H probably benign Het
Col5a3 T C 9: 20,775,485 E1323G unknown Het
Cttnbp2 A G 6: 18,367,373 *1139Q probably null Het
Cyp2d9 T A 15: 82,455,790 I127N probably damaging Het
Dennd1b A G 1: 139,081,219 Y220C probably damaging Het
Desi2 T C 1: 178,249,352 S141P possibly damaging Het
Dgcr2 A G 16: 17,844,008 S453P probably damaging Het
Dnah3 A G 7: 120,020,915 L1586P probably damaging Het
Dpep3 T C 8: 105,978,731 D129G possibly damaging Het
Eci3 C T 13: 34,948,143 V241I possibly damaging Het
Ecm2 A T 13: 49,521,083 probably benign Het
Emilin3 A G 2: 160,908,176 L551P probably damaging Het
Erap1 A C 13: 74,675,814 probably benign Het
Ern1 T C 11: 106,398,693 D928G probably benign Het
Fam214b G T 4: 43,036,242 P163Q probably damaging Het
Fancc C A 13: 63,317,478 A472S probably damaging Het
Fkbp7 A T 2: 76,672,844 D57E probably damaging Het
Gabbr2 T A 4: 46,681,223 I703F possibly damaging Het
Gabrg3 A T 7: 56,724,595 C408S probably damaging Het
Gm13119 C A 4: 144,362,846 L245I probably benign Het
Gm13757 A G 2: 88,446,219 S240P probably damaging Het
Gm8674 T C 13: 49,899,715 noncoding transcript Het
Gnas G A 2: 174,298,135 probably benign Het
Grhl3 A G 4: 135,552,681 V354A probably benign Het
Gsdme G T 6: 50,229,279 probably benign Het
H2-D1 A G 17: 35,265,922 E253G probably damaging Het
Habp2 A G 19: 56,314,046 T31A probably damaging Het
Ifrd1 A G 12: 40,206,987 probably null Het
Il20 A G 1: 130,909,739 probably benign Het
Isx A T 8: 74,892,700 I160F possibly damaging Het
Itgb2l T G 16: 96,422,911 probably benign Het
Kcnv1 T G 15: 45,112,881 probably benign Het
Kif17 T C 4: 138,288,487 probably null Het
Kirrel3 A C 9: 35,035,174 D743A probably damaging Het
Lmod3 T C 6: 97,248,071 D263G probably damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Mark2 C T 19: 7,281,960 probably null Het
Med10 G A 13: 69,815,601 S107N possibly damaging Het
Med31 A G 11: 72,213,775 probably null Het
Mki67 C A 7: 135,708,258 A155S probably benign Het
Mprip T A 11: 59,769,972 L2193Q probably damaging Het
Mylk A G 16: 35,000,429 N126S probably damaging Het
Myo16 A G 8: 10,439,689 I715V probably benign Het
Myo18b T C 5: 112,798,834 T1591A probably benign Het
Myt1 T A 2: 181,795,689 D64E probably benign Het
Ndufa10 A T 1: 92,469,896 Y61N probably damaging Het
Nob1 A G 8: 107,416,224 F275S probably damaging Het
Nop2 T C 6: 125,139,704 V333A possibly damaging Het
Ogdh T A 11: 6,347,216 V545D possibly damaging Het
Olfr1101 T C 2: 86,989,014 N54S probably benign Het
Olfr1461 A G 19: 13,165,250 T79A probably benign Het
Olfr213 T A 6: 116,540,988 N178K possibly damaging Het
Olfr364-ps1 T G 2: 37,146,330 N39K probably damaging Het
Olfr430 G T 1: 174,070,077 V260F probably damaging Het
Olfr826 A G 10: 130,180,688 F64S probably damaging Het
Pcdhb1 T C 18: 37,265,721 F242L probably damaging Het
Pkd2l2 A G 18: 34,425,102 Y278C probably damaging Het
Plxdc1 T A 11: 97,932,204 probably null Het
Ppp2r5b A G 19: 6,232,634 probably benign Het
Prelid2 T A 18: 41,937,652 T39S possibly damaging Het
Prkd1 A T 12: 50,490,041 F87I probably benign Het
Prl3d3 C T 13: 27,156,847 T4I probably damaging Het
Proser3 T A 7: 30,540,783 T299S probably benign Het
Ptprc G T 1: 138,068,320 H1095N probably damaging Het
Rab11fip5 G T 6: 85,348,051 P425T probably benign Het
Rac2 T C 15: 78,564,968 T115A probably damaging Het
Rtl9 C A X: 143,101,275 T561K possibly damaging Het
Runx2 T C 17: 44,658,505 probably benign Het
Rxfp1 C T 3: 79,648,211 V613I probably benign Het
Scn9a T C 2: 66,537,377 K656R probably benign Het
Sec31b A G 19: 44,525,607 S406P probably benign Het
Sept5 T C 16: 18,625,365 D44G possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc35c2 T C 2: 165,282,136 T94A possibly damaging Het
Slc8a3 T A 12: 81,314,842 D401V probably damaging Het
Slitrk1 A T 14: 108,912,239 C347S probably damaging Het
Smg1 G T 7: 118,167,861 probably benign Het
Snx14 T C 9: 88,394,430 K610E probably benign Het
Sppl2a A G 2: 126,920,417 probably benign Het
Stk-ps2 T A 1: 46,029,691 noncoding transcript Het
Sult3a1 T C 10: 33,864,014 M23T probably benign Het
Syt5 A G 7: 4,545,683 L50P possibly damaging Het
Tacr1 A G 6: 82,555,031 I303V possibly damaging Het
Vcp A G 4: 42,983,011 S612P possibly damaging Het
Vmn1r47 A G 6: 90,022,806 I307V probably null Het
Vmn1r83 T G 7: 12,321,992 D46A probably damaging Het
Vmn2r118 G T 17: 55,610,772 Q247K probably benign Het
Vmn2r94 C T 17: 18,257,165 C328Y probably damaging Het
Vps13b T A 15: 35,371,999 Y13* probably null Het
Vps13d C T 4: 145,087,184 R3241H probably damaging Het
Wdr5b A G 16: 36,042,470 T320A probably benign Het
Zfhx2 A T 14: 55,065,327 D1733E probably benign Het
Zfp541 A G 7: 16,095,682 probably benign Het
Zfp708 A T 13: 67,070,717 Y314* probably null Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84730541 missense probably damaging 1.00
IGL00430:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00465:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00819:Trip12 APN 1 84754272 missense probably damaging 1.00
IGL00900:Trip12 APN 1 84724764 missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84751884 missense probably damaging 0.99
IGL01087:Trip12 APN 1 84757859 missense probably damaging 0.99
IGL01400:Trip12 APN 1 84751978 missense probably damaging 0.99
IGL01521:Trip12 APN 1 84766198 splice site probably benign
IGL01619:Trip12 APN 1 84814910 missense probably damaging 0.99
IGL01796:Trip12 APN 1 84728278 missense probably benign 0.42
IGL01975:Trip12 APN 1 84814813 splice site probably benign
IGL02190:Trip12 APN 1 84766070 missense probably damaging 0.98
IGL02474:Trip12 APN 1 84794133 missense probably benign
IGL02517:Trip12 APN 1 84743814 unclassified probably benign
IGL02631:Trip12 APN 1 84766008 missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84738815 missense probably damaging 1.00
IGL03161:Trip12 APN 1 84761132 unclassified probably benign
IGL03388:Trip12 APN 1 84743186 missense probably damaging 0.99
cardamom UTSW 1 84749276 missense probably damaging 0.99
Turmeric UTSW 1 84754343 missense probably benign 0.07
LCD18:Trip12 UTSW 1 84754482 unclassified probably benign
R0090:Trip12 UTSW 1 84732136 splice site probably benign
R0111:Trip12 UTSW 1 84759133 unclassified probably benign
R0471:Trip12 UTSW 1 84726207 missense probably damaging 1.00
R0486:Trip12 UTSW 1 84761084 nonsense probably null
R0557:Trip12 UTSW 1 84724747 missense probably damaging 1.00
R0570:Trip12 UTSW 1 84751548 missense probably damaging 1.00
R0614:Trip12 UTSW 1 84757761 missense probably damaging 1.00
R0630:Trip12 UTSW 1 84793915 missense possibly damaging 0.70
R0657:Trip12 UTSW 1 84759050 missense probably benign 0.19
R0741:Trip12 UTSW 1 84745181 missense probably benign 0.09
R0862:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R0864:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R1124:Trip12 UTSW 1 84737037 missense probably damaging 1.00
R1252:Trip12 UTSW 1 84776350 nonsense probably null
R1455:Trip12 UTSW 1 84759100 missense probably benign 0.01
R1487:Trip12 UTSW 1 84768631 missense probably damaging 1.00
R1702:Trip12 UTSW 1 84745063 missense probably damaging 1.00
R1781:Trip12 UTSW 1 84730621 missense probably benign 0.01
R1847:Trip12 UTSW 1 84749269 missense probably damaging 1.00
R1854:Trip12 UTSW 1 84728145 missense probably damaging 1.00
R1866:Trip12 UTSW 1 84745060 missense probably damaging 1.00
R1926:Trip12 UTSW 1 84749291 missense probably damaging 0.98
R1935:Trip12 UTSW 1 84794101 missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84760801 missense probably damaging 1.00
R1994:Trip12 UTSW 1 84749172 missense probably damaging 1.00
R2014:Trip12 UTSW 1 84760866 nonsense probably null
R2391:Trip12 UTSW 1 84814790 frame shift probably null
R2423:Trip12 UTSW 1 84814790 frame shift probably null
R2433:Trip12 UTSW 1 84743823 missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84754343 missense probably benign 0.07
R3040:Trip12 UTSW 1 84742245 missense probably benign 0.13
R3735:Trip12 UTSW 1 84814790 frame shift probably null
R3907:Trip12 UTSW 1 84732106 missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84725741 missense probably damaging 1.00
R4540:Trip12 UTSW 1 84749276 missense probably damaging 0.99
R4859:Trip12 UTSW 1 84793810 missense probably damaging 0.99
R5240:Trip12 UTSW 1 84794133 missense probably benign
R5278:Trip12 UTSW 1 84762147 missense probably damaging 1.00
R5377:Trip12 UTSW 1 84757431 missense probably damaging 1.00
R5510:Trip12 UTSW 1 84768680 missense probably damaging 1.00
R5542:Trip12 UTSW 1 84749344 missense probably damaging 1.00
R5550:Trip12 UTSW 1 84761099 missense probably damaging 0.99
R5886:Trip12 UTSW 1 84730458 intron probably benign
R5893:Trip12 UTSW 1 84759163 unclassified probably benign
R5914:Trip12 UTSW 1 84763458 missense probably damaging 1.00
R5925:Trip12 UTSW 1 84749253 nonsense probably null
R5985:Trip12 UTSW 1 84725771 missense probably damaging 0.99
R6135:Trip12 UTSW 1 84760838 missense probably benign 0.00
R6158:Trip12 UTSW 1 84761012 missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84793870 missense probably damaging 1.00
R6816:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7144:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7194:Trip12 UTSW 1 84794222 missense probably benign 0.07
R7355:Trip12 UTSW 1 84814883 missense probably damaging 1.00
R7361:Trip12 UTSW 1 84750442 missense probably damaging 0.98
R7588:Trip12 UTSW 1 84760883 missense probably damaging 0.99
R7705:Trip12 UTSW 1 84777449 missense probably damaging 1.00
R7818:Trip12 UTSW 1 84760806 missense probably damaging 1.00
X0023:Trip12 UTSW 1 84760787 missense probably benign 0.12
X0065:Trip12 UTSW 1 84749163 missense probably benign 0.21
Z1088:Trip12 UTSW 1 84766168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGCCATCTCATGTACTTCCTTAACT -3'
(R):5'- TCTTTTCTCTTGAAGGTTCTAAGGCCCA -3'

Sequencing Primer
(F):5'- TCAAAGCATCACTAATGGGCTG -3'
(R):5'- AGCAGCTTCTTCAAGGACTAC -3'
Posted On2013-07-11