Incidental Mutation 'R7422:Frem3'
ID575743
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7422 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 80615763 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1562 (I1562L)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably benign
Transcript: ENSMUST00000039695
AA Change: I1562L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: I1562L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,881,059 C456S probably damaging Het
4930524J08Rik T C 5: 99,979,209 probably benign Het
Adam28 T G 14: 68,626,877 R492S probably damaging Het
Adarb2 G A 13: 8,757,277 A705T possibly damaging Het
Adprhl1 T C 8: 13,222,873 D1295G probably benign Het
Aldh3b3 A G 19: 3,966,476 I365V probably benign Het
Aldh8a1 T C 10: 21,389,097 F208L possibly damaging Het
Ap3b1 G A 13: 94,528,165 V871I unknown Het
Apol7e A T 15: 77,714,352 R6* probably null Het
Arfgap3 T C 15: 83,306,949 E456G probably damaging Het
Arhgef1 T C 7: 24,916,036 L285P probably benign Het
Arhgef7 T A 8: 11,800,861 C315S probably benign Het
Atp9a A T 2: 168,648,593 L829Q probably damaging Het
Bptf C T 11: 107,060,558 R2185H probably damaging Het
Brd9 A C 13: 73,954,578 M473L probably benign Het
C7 T C 15: 5,012,056 H456R probably benign Het
Cabp7 C A 11: 4,738,856 A205S probably damaging Het
Catsperb A G 12: 101,588,034 I662M probably damaging Het
Ccl21a T C 4: 42,773,906 M5V probably benign Het
Cdyl G T 13: 35,858,194 R405L possibly damaging Het
Cep89 T C 7: 35,428,247 L538P probably damaging Het
Cercam A G 2: 29,872,880 M209V possibly damaging Het
Cntnap5c T A 17: 58,410,231 Y1269* probably null Het
Col6a2 G T 10: 76,603,336 C833* probably null Het
Cpeb3 T A 19: 37,174,500 I159F probably benign Het
Cplx2 G A 13: 54,378,850 E24K possibly damaging Het
Ctsb A G 14: 63,142,303 T332A probably benign Het
Cyp2j12 T A 4: 96,140,985 T20S probably benign Het
Dcst2 T A 3: 89,366,686 H181Q probably damaging Het
Dnm1l T C 16: 16,318,474 I411V probably benign Het
Dock5 T A 14: 67,809,030 I768F probably benign Het
Dpcr1 T A 17: 35,638,420 T96S probably benign Het
Ecel1 A G 1: 87,149,612 Y625H probably damaging Het
Efl1 T G 7: 82,681,379 S253R probably damaging Het
Elmod1 T A 9: 53,912,843 D287V probably damaging Het
Fam171a2 T C 11: 102,438,665 S423G probably benign Het
Fbxo8 A T 8: 56,569,282 probably null Het
Flnc G T 6: 29,455,471 G2040W probably damaging Het
Fras1 C T 5: 96,673,599 A1405V probably benign Het
Fxr1 C T 3: 34,049,220 A233V probably damaging Het
Helb A G 10: 120,108,894 F246L probably damaging Het
Hils1 A G 11: 94,968,358 R160G possibly damaging Het
Hoxb6 G T 11: 96,292,684 probably benign Het
Hspa2 A G 12: 76,406,110 E526G probably damaging Het
Hyal5 A T 6: 24,875,984 probably benign Het
Ints6 A T 14: 62,704,775 V503E probably benign Het
Ints9 C T 14: 65,032,298 T479I possibly damaging Het
Jag1 C T 2: 137,085,055 R928H probably benign Het
Lman2 A T 13: 55,351,525 I179N probably damaging Het
Lta T C 17: 35,203,829 S173G probably benign Het
Mgea5 ATCAT A 19: 45,776,175 probably null Het
Mki67 G A 7: 135,698,370 P1645L probably damaging Het
Muc4 T A 16: 32,754,689 M1521K probably benign Het
Mylk3 T G 8: 85,355,244 D438A probably benign Het
Nsmce4a G T 7: 130,533,817 Q342K probably benign Het
Olfr1232 T A 2: 89,326,079 I34F probably benign Het
Olfr455 A G 6: 42,538,119 I301T possibly damaging Het
Olfr484 A G 7: 108,124,861 L134P probably damaging Het
Olfr808 A T 10: 129,768,267 Y257F possibly damaging Het
Osbpl6 T A 2: 76,593,386 F864L probably damaging Het
Pla2g4a A G 1: 149,932,687 S2P probably benign Het
Plce1 T C 19: 38,651,885 L525P probably damaging Het
Por A T 5: 135,734,919 M667L probably benign Het
Psma4 T C 9: 54,954,882 Y97H probably benign Het
Qtrt1 A T 9: 21,412,457 H126L probably benign Het
Rab3a A T 8: 70,756,523 Y102F possibly damaging Het
Rnf212 T A 5: 108,731,689 H87L probably benign Het
Rnf216 A G 5: 143,090,836 S98P probably benign Het
Ryr1 G T 7: 29,085,870 R1806S probably benign Het
Scgb1b3 A T 7: 31,375,837 L37F probably benign Het
Sds T C 5: 120,479,189 S37P probably damaging Het
Senp6 A G 9: 80,113,877 R280G probably damaging Het
She T A 3: 89,854,557 I441K possibly damaging Het
Slc6a20b A G 9: 123,607,617 S244P possibly damaging Het
Slc9a3 A T 13: 74,150,885 Y141F probably damaging Het
Slco6c1 A T 1: 97,081,482 H426Q probably benign Het
Smc2 C A 4: 52,440,301 Q16K probably benign Het
Sphkap A C 1: 83,263,826 V1535G probably benign Het
Stard9 C A 2: 120,702,152 N2963K probably benign Het
Sycp2 C T 2: 178,394,151 A248T probably damaging Het
Taar8a T C 10: 24,076,864 L122P probably damaging Het
Tab1 T A 15: 80,160,244 V491E probably benign Het
Tanc1 T C 2: 59,806,344 M857T probably benign Het
Tcirg1 C A 19: 3,899,008 R427L possibly damaging Het
Tmem109 A C 19: 10,871,760 *244G probably null Het
Tox2 A G 2: 163,321,515 Y136C Het
Tubb1 T C 2: 174,457,032 V169A possibly damaging Het
Ubr3 T C 2: 69,953,542 probably null Het
Vmn1r225 T A 17: 20,502,797 F167I probably benign Het
Vmn2r65 A C 7: 84,946,361 W372G probably damaging Het
Vps13a A T 19: 16,750,173 D188E probably damaging Het
Vsnl1 G T 12: 11,326,438 Q149K probably benign Het
Wdr35 A G 12: 9,004,105 N466S probably benign Het
Ywhae T A 11: 75,759,343 S210R probably damaging Het
Zfp28 T A 7: 6,394,749 S728T probably damaging Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 intron probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACCACTTTGAGCTTAGAGTGACTG -3'
(R):5'- TGTGTCTCCAGGGAAGTGTC -3'

Sequencing Primer
(F):5'- TGGAGGACACCACTCTGAGTC -3'
(R):5'- AAGCCTGTGTGGATTCCATCAGTC -3'
Posted On2019-10-07