Mutagenetix > Incidental Mutation

Incidental Mutation 'R0627:Ptprc'

57577

Institutional Source

Beutler Lab

Gene Symbol

Ptprc

Ensembl Gene

ENSMUSG00000026395

Gene Name

protein tyrosine phosphatase, receptor type, C

Synonyms

B220, Ly-5, Lyt-4, CD45, T200

MMRRC Submission

038816-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0627 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

138062861-138175708 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 138068320 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 1095 (H1095N)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]

AlphaFold

P06800

Predicted Effect

probably damaging
Transcript: ENSMUST00000027645
AA Change: H1095N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027645
Gene: ENSMUSG00000026395
AA Change: H1095N

Domain	Start	End	E-Value	Type
Pfam:PTP_N	5	30	5e-16	PFAM
low complexity region	109	126	N/A	INTRINSIC
low complexity region	168	203	N/A	INTRINSIC
Pfam:CD45	210	267	3.1e-20	PFAM
FN3	372	456	2.28e0	SMART
FN3	472	550	3.48e-1	SMART
transmembrane domain	565	586	N/A	INTRINSIC
PTPc	639	901	7.57e-127	SMART
PTPc	930	1216	1.39e-102	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112036

SMART Domains

Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	5	30	5.8e-13	PFAM
low complexity region	31	64	N/A	INTRINSIC
Pfam:CD45	70	129	1.8e-24	PFAM
FN3	233	317	2.28e0	SMART
FN3	333	411	3.48e-1	SMART
transmembrane domain	426	447	N/A	INTRINSIC
PTPc	500	762	7.57e-127	SMART
PTPc	791	1077	1.39e-102	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182283
AA Change: H958N

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: H958N

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	32	4.2e-13	PFAM
low complexity region	33	66	N/A	INTRINSIC
Pfam:CD45	72	131	2.3e-24	PFAM
FN3	235	319	2.28e0	SMART
FN3	335	413	3.48e-1	SMART
transmembrane domain	428	449	N/A	INTRINSIC
PTPc	502	764	7.57e-127	SMART
PTPc	793	1079	1.39e-102	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182755
AA Change: H934N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: H934N

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	34	5.5e-13	PFAM
Pfam:CD45	48	107	2.3e-24	PFAM
FN3	211	295	2.28e0	SMART
FN3	311	389	3.48e-1	SMART
transmembrane domain	404	425	N/A	INTRINSIC
PTPc	478	740	7.57e-127	SMART
PTPc	769	1055	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183301
AA Change: H1097N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: H1097N

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	2.7e-13	PFAM
low complexity region	111	128	N/A	INTRINSIC
low complexity region	170	205	N/A	INTRINSIC
Pfam:CD45	211	270	2.1e-24	PFAM
FN3	374	458	2.28e0	SMART
FN3	474	552	3.48e-1	SMART
transmembrane domain	567	588	N/A	INTRINSIC
PTPc	641	903	7.57e-127	SMART
PTPc	932	1218	1.39e-102	SMART

Meta Mutation Damage Score

0.2550

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.2%
20x: 94.2%

Validation Efficiency

99% (111/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	G	1: 26,685,889	M70T	probably benign	Het
Adm2	T	A	15: 89,324,305	Y149*	probably null	Het
Ahi1	G	A	10: 20,965,522	R236H	probably benign	Het
Armcx4	A	G	X: 134,695,823	N2160S	possibly damaging	Het
Asns	A	T	6: 7,675,516	D495E	probably benign	Het
Bcl9	A	G	3: 97,205,473	V1222A	probably damaging	Het
Cd46	A	T	1: 195,092,186	C14S	probably benign	Het
Cdk11b	T	A	4: 155,640,772		probably benign	Het
Cdkl3	T	C	11: 52,011,308	Y115H	probably damaging	Het
Cep41	C	A	6: 30,656,631	C274F	probably damaging	Het
Ces1a	C	A	8: 93,042,043	V108F	probably benign	Het
Clca4b	A	G	3: 144,928,259	Y132H	probably benign	Het
Col5a3	T	C	9: 20,775,485	E1323G	unknown	Het
Cttnbp2	A	G	6: 18,367,373	*1139Q	probably null	Het
Cyp2d9	T	A	15: 82,455,790	I127N	probably damaging	Het
Dennd1b	A	G	1: 139,081,219	Y220C	probably damaging	Het
Desi2	T	C	1: 178,249,352	S141P	possibly damaging	Het
Dgcr2	A	G	16: 17,844,008	S453P	probably damaging	Het
Dnah3	A	G	7: 120,020,915	L1586P	probably damaging	Het
Dpep3	T	C	8: 105,978,731	D129G	possibly damaging	Het
Eci3	C	T	13: 34,948,143	V241I	possibly damaging	Het
Ecm2	A	T	13: 49,521,083		probably benign	Het
Emilin3	A	G	2: 160,908,176	L551P	probably damaging	Het
Erap1	A	C	13: 74,675,814		probably benign	Het
Ern1	T	C	11: 106,398,693	D928G	probably benign	Het
Fam214b	G	T	4: 43,036,242	P163Q	probably damaging	Het
Fancc	C	A	13: 63,317,478	A472S	probably damaging	Het
Fkbp7	A	T	2: 76,672,844	D57E	probably damaging	Het
Gabbr2	T	A	4: 46,681,223	I703F	possibly damaging	Het
Gabrg3	A	T	7: 56,724,595	C408S	probably damaging	Het
Gm13119	C	A	4: 144,362,846	L245I	probably benign	Het
Gm13757	A	G	2: 88,446,219	S240P	probably damaging	Het
Gm8674	T	C	13: 49,899,715		noncoding transcript	Het
Gnas	G	A	2: 174,298,135		probably benign	Het
Grhl3	A	G	4: 135,552,681	V354A	probably benign	Het
Gsdme	G	T	6: 50,229,279		probably benign	Het
H2-D1	A	G	17: 35,265,922	E253G	probably damaging	Het
Habp2	A	G	19: 56,314,046	T31A	probably damaging	Het
Ifrd1	A	G	12: 40,206,987		probably null	Het
Il20	A	G	1: 130,909,739		probably benign	Het
Isx	A	T	8: 74,892,700	I160F	possibly damaging	Het
Itgb2l	T	G	16: 96,422,911		probably benign	Het
Kcnv1	T	G	15: 45,112,881		probably benign	Het
Kif17	T	C	4: 138,288,487		probably null	Het
Kirrel3	A	C	9: 35,035,174	D743A	probably damaging	Het
Lmod3	T	C	6: 97,248,071	D263G	probably damaging	Het
Manf	A	G	9: 106,889,186	L132P	probably damaging	Het
Mark2	C	T	19: 7,281,960		probably null	Het
Med10	G	A	13: 69,815,601	S107N	possibly damaging	Het
Med31	A	G	11: 72,213,775		probably null	Het
Mki67	C	A	7: 135,708,258	A155S	probably benign	Het
Mprip	T	A	11: 59,769,972	L2193Q	probably damaging	Het
Mylk	A	G	16: 35,000,429	N126S	probably damaging	Het
Myo16	A	G	8: 10,439,689	I715V	probably benign	Het
Myo18b	T	C	5: 112,798,834	T1591A	probably benign	Het
Myt1	T	A	2: 181,795,689	D64E	probably benign	Het
Ndufa10	A	T	1: 92,469,896	Y61N	probably damaging	Het
Nob1	A	G	8: 107,416,224	F275S	probably damaging	Het
Nop2	T	C	6: 125,139,704	V333A	possibly damaging	Het
Ogdh	T	A	11: 6,347,216	V545D	possibly damaging	Het
Olfr1101	T	C	2: 86,989,014	N54S	probably benign	Het
Olfr1461	A	G	19: 13,165,250	T79A	probably benign	Het
Olfr213	T	A	6: 116,540,988	N178K	possibly damaging	Het
Olfr364-ps1	T	G	2: 37,146,330	N39K	probably damaging	Het
Olfr430	G	T	1: 174,070,077	V260F	probably damaging	Het
Olfr826	A	G	10: 130,180,688	F64S	probably damaging	Het
Pcdhb1	T	C	18: 37,265,721	F242L	probably damaging	Het
Pkd2l2	A	G	18: 34,425,102	Y278C	probably damaging	Het
Plxdc1	T	A	11: 97,932,204		probably null	Het
Ppp2r5b	A	G	19: 6,232,634		probably benign	Het
Prelid2	T	A	18: 41,937,652	T39S	possibly damaging	Het
Prkd1	A	T	12: 50,490,041	F87I	probably benign	Het
Prl3d3	C	T	13: 27,156,847	T4I	probably damaging	Het
Proser3	T	A	7: 30,540,783	T299S	probably benign	Het
Rab11fip5	G	T	6: 85,348,051	P425T	probably benign	Het
Rac2	T	C	15: 78,564,968	T115A	probably damaging	Het
Rtl9	C	A	X: 143,101,275	T561K	possibly damaging	Het
Runx2	T	C	17: 44,658,505		probably benign	Het
Rxfp1	C	T	3: 79,648,211	V613I	probably benign	Het
Scn9a	T	C	2: 66,537,377	K656R	probably benign	Het
Sec31b	A	G	19: 44,525,607	S406P	probably benign	Het
Sept5	T	C	16: 18,625,365	D44G	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc35c2	T	C	2: 165,282,136	T94A	possibly damaging	Het
Slc8a3	T	A	12: 81,314,842	D401V	probably damaging	Het
Slitrk1	A	T	14: 108,912,239	C347S	probably damaging	Het
Smg1	G	T	7: 118,167,861		probably benign	Het
Snx14	T	C	9: 88,394,430	K610E	probably benign	Het
Sppl2a	A	G	2: 126,920,417		probably benign	Het
Stk-ps2	T	A	1: 46,029,691		noncoding transcript	Het
Sult3a1	T	C	10: 33,864,014	M23T	probably benign	Het
Syt5	A	G	7: 4,545,683	L50P	possibly damaging	Het
Tacr1	A	G	6: 82,555,031	I303V	possibly damaging	Het
Trip12	C	A	1: 84,768,597	V487F	probably damaging	Het
Vcp	A	G	4: 42,983,011	S612P	possibly damaging	Het
Vmn1r47	A	G	6: 90,022,806	I307V	probably null	Het
Vmn1r83	T	G	7: 12,321,992	D46A	probably damaging	Het
Vmn2r118	G	T	17: 55,610,772	Q247K	probably benign	Het
Vmn2r94	C	T	17: 18,257,165	C328Y	probably damaging	Het
Vps13b	T	A	15: 35,371,999	Y13*	probably null	Het
Vps13d	C	T	4: 145,087,184	R3241H	probably damaging	Het
Wdr5b	A	G	16: 36,042,470	T320A	probably benign	Het
Zfhx2	A	T	14: 55,065,327	D1733E	probably benign	Het
Zfp541	A	G	7: 16,095,682		probably benign	Het
Zfp708	A	T	13: 67,070,717	Y314*	probably null	Het

Other mutations in Ptprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
lochy	APN	1	138083790	splice site	probably benign
IGL00486:Ptprc	APN	1	138115621	missense	probably damaging	0.97
IGL00771:Ptprc	APN	1	138113677	missense	probably benign	0.00
IGL00833:Ptprc	APN	1	138078492	missense	possibly damaging	0.55
IGL00919:Ptprc	APN	1	138113642	missense	probably damaging	1.00
IGL01020:Ptprc	APN	1	138120173	critical splice acceptor site	probably null	0.00
IGL01024:Ptprc	APN	1	138080912	missense	probably damaging	1.00
IGL01302:Ptprc	APN	1	138099631	missense	possibly damaging	0.82
IGL01548:Ptprc	APN	1	138099481	critical splice donor site	probably null	0.00
IGL01620:Ptprc	APN	1	138068410	missense	possibly damaging	0.88
IGL01775:Ptprc	APN	1	138064759	missense	probably damaging	1.00
IGL01820:Ptprc	APN	1	138066198	missense	probably damaging	1.00
IGL02340:Ptprc	APN	1	138071219	missense	probably damaging	1.00
IGL02943:Ptprc	APN	1	138099513	missense	probably damaging	0.99
IGL03169:Ptprc	APN	1	138113619	missense	probably benign	0.15
IGL03308:Ptprc	APN	1	138126320	missense	possibly damaging	0.70
IGL03404:Ptprc	APN	1	138093001	missense	probably damaging	1.00
belittle	UTSW	1	138137493	intron	probably benign
Benighted	UTSW	1	138126301	critical splice donor site	probably null
bletchley	UTSW	1	138117862	missense	probably benign
Blush	UTSW	1	138117720	intron	probably benign
bruise	UTSW	1	138064771	missense	probably damaging	1.00
chor_muang	UTSW	1	138113562	critical splice donor site	probably null
crystal	UTSW	1	138072255	critical splice donor site	probably null
Dumpling	UTSW	1	138067890	missense	probably damaging	1.00
fluorescent	UTSW	1	138101192	missense	probably damaging	0.97
fuchsia	UTSW	1	138101041	critical splice donor site	probably null
Gentian	UTSW	1	138067885	critical splice donor site	probably null
guotie	UTSW	1	138068401	nonsense	probably null
guotie2	UTSW	1	138094299	missense	probably damaging	0.97
Guotie3	UTSW	1	138078451	missense	possibly damaging	0.92
Gyoza	UTSW	1	138083567	missense	probably damaging	1.00
Half_measure	UTSW	1	138071249	missense	probably damaging	0.98
jirisan	UTSW	1	138113678	nonsense	probably null
mauve	UTSW	1	138099685	missense	probably benign
Perverse	UTSW	1	138101044	missense	probably benign	0.02
petechiae	UTSW	1	138113708	nonsense	probably null
ultra	UTSW	1	138078445	critical splice donor site	probably null
violaceous	UTSW	1	138083639	missense	possibly damaging	0.77
R0013:Ptprc	UTSW	1	138113559	splice site	probably null
R0189:Ptprc	UTSW	1	138082715	missense	probably benign	0.10
R0390:Ptprc	UTSW	1	138122575	missense	possibly damaging	0.71
R0504:Ptprc	UTSW	1	138088697	missense	probably damaging	1.00
R0602:Ptprc	UTSW	1	138089485	splice site	probably benign
R0632:Ptprc	UTSW	1	138073610	missense	probably benign	0.01
R0751:Ptprc	UTSW	1	138092930	missense	probably damaging	1.00
R0839:Ptprc	UTSW	1	138101132	missense	possibly damaging	0.47
R0942:Ptprc	UTSW	1	138068401	nonsense	probably null
R0943:Ptprc	UTSW	1	138111164	missense	probably damaging	0.96
R1159:Ptprc	UTSW	1	138072319	missense	probably damaging	1.00
R1442:Ptprc	UTSW	1	138072312	missense	probably damaging	1.00
R1489:Ptprc	UTSW	1	138120086	missense	possibly damaging	0.91
R1728:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1728:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1728:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1728:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1728:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1729:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1729:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1729:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1729:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1729:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1730:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1730:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1730:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1730:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1730:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1739:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1739:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1739:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1739:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1739:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1762:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1762:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1762:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1762:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1762:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1783:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1783:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1783:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1783:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1783:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1784:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1784:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1784:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1784:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1784:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1785:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1785:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1785:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1785:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1785:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1862:Ptprc	UTSW	1	138112227	missense	probably benign	0.13
R2145:Ptprc	UTSW	1	138073681	missense	probably damaging	1.00
R2290:Ptprc	UTSW	1	138111188	missense	probably benign	0.00
R2403:Ptprc	UTSW	1	138088532	missense	probably damaging	1.00
R2439:Ptprc	UTSW	1	138066152	missense	possibly damaging	0.67
R2887:Ptprc	UTSW	1	138080178	missense	probably damaging	1.00
R2906:Ptprc	UTSW	1	138064534	missense	possibly damaging	0.93
R3774:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3775:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3776:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3834:Ptprc	UTSW	1	138083567	missense	probably damaging	1.00
R4019:Ptprc	UTSW	1	138078516	missense	probably damaging	1.00
R4377:Ptprc	UTSW	1	138067925	missense	probably benign	0.04
R4580:Ptprc	UTSW	1	138071251	missense	probably benign	0.09
R4923:Ptprc	UTSW	1	138078498	missense	possibly damaging	0.93
R4925:Ptprc	UTSW	1	138099497	missense	probably benign	0.04
R4937:Ptprc	UTSW	1	138089500	missense	probably damaging	1.00
R4970:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5112:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5145:Ptprc	UTSW	1	138089566	missense	probably benign	0.07
R5158:Ptprc	UTSW	1	138175084	missense	possibly damaging	0.75
R5223:Ptprc	UTSW	1	138117862	missense	probably benign
R5593:Ptprc	UTSW	1	138117720	intron	probably benign
R5689:Ptprc	UTSW	1	138117777	missense	probably benign	0.01
R5885:Ptprc	UTSW	1	138088508	missense	probably damaging	1.00
R6010:Ptprc	UTSW	1	138101056	missense	probably benign	0.09
R6026:Ptprc	UTSW	1	138071249	missense	probably damaging	0.98
R6047:Ptprc	UTSW	1	138101041	critical splice donor site	probably null
R6173:Ptprc	UTSW	1	138067890	missense	probably damaging	1.00
R6328:Ptprc	UTSW	1	138113678	nonsense	probably null
R6383:Ptprc	UTSW	1	138078451	missense	possibly damaging	0.92
R6436:Ptprc	UTSW	1	138083639	missense	possibly damaging	0.77
R6492:Ptprc	UTSW	1	138113562	critical splice donor site	probably null
R6520:Ptprc	UTSW	1	138080143	nonsense	probably null
R6805:Ptprc	UTSW	1	138067885	critical splice donor site	probably null
R6830:Ptprc	UTSW	1	138072255	critical splice donor site	probably null
R6847:Ptprc	UTSW	1	138088545	missense	probably damaging	0.99
R6960:Ptprc	UTSW	1	138078445	critical splice donor site	probably null
R6995:Ptprc	UTSW	1	138088744	missense	probably damaging	1.00
R7009:Ptprc	UTSW	1	138064553	missense	probably damaging	0.97
R7041:Ptprc	UTSW	1	138126309	missense	probably benign	0.04
R7055:Ptprc	UTSW	1	138089571	missense	probably damaging	1.00
R7098:Ptprc	UTSW	1	138099685	missense	probably benign
R7164:Ptprc	UTSW	1	138117862	missense	probably benign
R7188:Ptprc	UTSW	1	138071180	missense	probably damaging	1.00
R7191:Ptprc	UTSW	1	138101044	missense	probably benign	0.02
R7204:Ptprc	UTSW	1	138117862	missense	probably benign
R7316:Ptprc	UTSW	1	138064771	missense	probably damaging	1.00
R7644:Ptprc	UTSW	1	138067907	missense	probably benign	0.01
R7948:Ptprc	UTSW	1	138064576	missense	probably benign	0.45
R8029:Ptprc	UTSW	1	138078459	missense	probably damaging	1.00
R8677:Ptprc	UTSW	1	138083597	missense	probably damaging	1.00
R8704:Ptprc	UTSW	1	138115624	missense	probably benign	0.34
R8824:Ptprc	UTSW	1	138113708	nonsense	probably null
R8921:Ptprc	UTSW	1	138126301	critical splice donor site	probably null
R8998:Ptprc	UTSW	1	138101192	missense	probably damaging	0.97
R8999:Ptprc	UTSW	1	138101192	missense	probably damaging	0.97
R9154:Ptprc	UTSW	1	138088564	missense	probably damaging	1.00
R9388:Ptprc	UTSW	1	138083642	missense	possibly damaging	0.87
R9428:Ptprc	UTSW	1	138113747	missense	probably benign	0.01
R9467:Ptprc	UTSW	1	138066222	missense	probably damaging	1.00
R9468:Ptprc	UTSW	1	138117016	missense	probably benign	0.01
R9479:Ptprc	UTSW	1	138073650	missense	probably benign	0.38
R9526:Ptprc	UTSW	1	138068373	missense	probably benign	0.02
R9632:Ptprc	UTSW	1	138080889	missense	probably damaging	1.00
R9710:Ptprc	UTSW	1	138080889	missense	probably damaging	1.00
R9714:Ptprc	UTSW	1	138080949	missense	probably damaging	1.00
R9777:Ptprc	UTSW	1	138120163	missense
Z1177:Ptprc	UTSW	1	138067907	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGCAGCAGCTACCAGCCTAAAA -3'
(R):5'- GGGGTTCTGAATACTTCAAAGAACAAAGACAA -3'

Sequencing Primer
(F):5'- ATCATAGACACCAGGTCTTTGGG -3'
(R):5'- AAGTCTGTGCTCAGTACTGG -3'

Posted On

2013-07-11