Incidental Mutation 'R7422:Dock5'
ID 575776
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms lr2, 1110060D06Rik, rlc
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock # R7422 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 67752135-67933442 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 67809030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 768 (I768F)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably benign
Transcript: ENSMUST00000039135
AA Change: I768F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: I768F

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,881,059 C456S probably damaging Het
4930524J08Rik T C 5: 99,979,209 probably benign Het
Adam28 T G 14: 68,626,877 R492S probably damaging Het
Adarb2 G A 13: 8,757,277 A705T possibly damaging Het
Adprhl1 T C 8: 13,222,873 D1295G probably benign Het
Aldh3b3 A G 19: 3,966,476 I365V probably benign Het
Aldh8a1 T C 10: 21,389,097 F208L possibly damaging Het
Ap3b1 G A 13: 94,528,165 V871I unknown Het
Apol7e A T 15: 77,714,352 R6* probably null Het
Arfgap3 T C 15: 83,306,949 E456G probably damaging Het
Arhgef1 T C 7: 24,916,036 L285P probably benign Het
Arhgef7 T A 8: 11,800,861 C315S probably benign Het
Atp9a A T 2: 168,648,593 L829Q probably damaging Het
Babam2 T A 5: 31,731,049 probably null Het
Bptf C T 11: 107,060,558 R2185H probably damaging Het
Brd9 A C 13: 73,954,578 M473L probably benign Het
C7 T C 15: 5,012,056 H456R probably benign Het
Cabp7 C A 11: 4,738,856 A205S probably damaging Het
Catsperb A G 12: 101,588,034 I662M probably damaging Het
Ccl21a T C 4: 42,773,906 M5V probably benign Het
Cdyl G T 13: 35,858,194 R405L possibly damaging Het
Cep89 T C 7: 35,428,247 L538P probably damaging Het
Cercam A G 2: 29,872,880 M209V possibly damaging Het
Chfr T A 5: 110,162,705 probably null Het
Cntnap5c T A 17: 58,410,231 Y1269* probably null Het
Col6a2 G T 10: 76,603,336 C833* probably null Het
Cpeb3 T A 19: 37,174,500 I159F probably benign Het
Cplx2 G A 13: 54,378,850 E24K possibly damaging Het
Ctsb A G 14: 63,142,303 T332A probably benign Het
Cyp2j12 T A 4: 96,140,985 T20S probably benign Het
Dcst2 T A 3: 89,366,686 H181Q probably damaging Het
Dnm1l T C 16: 16,318,474 I411V probably benign Het
Dpcr1 T A 17: 35,638,420 T96S probably benign Het
Ecel1 A G 1: 87,149,612 Y625H probably damaging Het
Efl1 T G 7: 82,681,379 S253R probably damaging Het
Elmod1 T A 9: 53,912,843 D287V probably damaging Het
Fam171a2 T C 11: 102,438,665 S423G probably benign Het
Fbxo8 A T 8: 56,569,282 probably null Het
Flnc G T 6: 29,455,471 G2040W probably damaging Het
Fras1 C T 5: 96,673,599 A1405V probably benign Het
Frem3 A C 8: 80,615,763 I1562L probably benign Het
Fxr1 C T 3: 34,049,220 A233V probably damaging Het
Helb A G 10: 120,108,894 F246L probably damaging Het
Hils1 A G 11: 94,968,358 R160G possibly damaging Het
Hoxb6 G T 11: 96,292,684 probably benign Het
Hspa2 A G 12: 76,406,110 E526G probably damaging Het
Hyal5 A T 6: 24,875,984 probably benign Het
Ints6 A T 14: 62,704,775 V503E probably benign Het
Ints9 C T 14: 65,032,298 T479I possibly damaging Het
Jag1 C T 2: 137,085,055 R928H probably benign Het
Lman2 A T 13: 55,351,525 I179N probably damaging Het
Lta T C 17: 35,203,829 S173G probably benign Het
Mki67 G A 7: 135,698,370 P1645L probably damaging Het
Mrc2 A T 11: 105,292,783 probably benign Het
Muc4 T A 16: 32,754,689 M1521K probably benign Het
Mylk3 T G 8: 85,355,244 D438A probably benign Het
Myo7a T A 7: 98,051,626 probably null Het
Nsmce4a G T 7: 130,533,817 Q342K probably benign Het
Olfr1232 T A 2: 89,326,079 I34F probably benign Het
Olfr455 A G 6: 42,538,119 I301T possibly damaging Het
Olfr484 A G 7: 108,124,861 L134P probably damaging Het
Olfr808 A T 10: 129,768,267 Y257F possibly damaging Het
Osbpl6 T A 2: 76,593,386 F864L probably damaging Het
Pla2g4a A G 1: 149,932,687 S2P probably benign Het
Plce1 T C 19: 38,651,885 L525P probably damaging Het
Por A T 5: 135,734,919 M667L probably benign Het
Psma4 T C 9: 54,954,882 Y97H probably benign Het
Qtrt1 A T 9: 21,412,457 H126L probably benign Het
Rab3a A T 8: 70,756,523 Y102F possibly damaging Het
Rnf212 T A 5: 108,731,689 H87L probably benign Het
Rnf216 A G 5: 143,090,836 S98P probably benign Het
Ryr1 G T 7: 29,085,870 R1806S probably benign Het
Scgb1b3 A T 7: 31,375,837 L37F probably benign Het
Sds T C 5: 120,479,189 S37P probably damaging Het
Senp6 A G 9: 80,113,877 R280G probably damaging Het
She T A 3: 89,854,557 I441K possibly damaging Het
Slc6a20b A G 9: 123,607,617 S244P possibly damaging Het
Slc9a3 A T 13: 74,150,885 Y141F probably damaging Het
Slco6c1 A T 1: 97,081,482 H426Q probably benign Het
Smc2 C A 4: 52,440,301 Q16K probably benign Het
Sphkap A C 1: 83,263,826 V1535G probably benign Het
Stard9 C A 2: 120,702,152 N2963K probably benign Het
Sycp2 C T 2: 178,394,151 A248T probably damaging Het
Taar8a T C 10: 24,076,864 L122P probably damaging Het
Tab1 T A 15: 80,160,244 V491E probably benign Het
Tanc1 T C 2: 59,806,344 M857T probably benign Het
Tcirg1 C A 19: 3,899,008 R427L possibly damaging Het
Tmem109 A C 19: 10,871,760 *244G probably null Het
Tox2 A G 2: 163,321,515 Y136C Het
Tubb1 T C 2: 174,457,032 V169A possibly damaging Het
Ubr3 T C 2: 69,953,542 probably null Het
Vmn1r225 T A 17: 20,502,797 F167I probably benign Het
Vmn2r65 A C 7: 84,946,361 W372G probably damaging Het
Vps13a A T 19: 16,750,173 D188E probably damaging Het
Vsnl1 G T 12: 11,326,438 Q149K probably benign Het
Wdr35 A G 12: 9,004,105 N466S probably benign Het
Ywhae T A 11: 75,759,343 S210R probably damaging Het
Zfp28 T A 7: 6,394,749 S728T probably damaging Het
Zfpm1 A G 8: 122,336,959 D919G unknown Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
R8972:Dock5 UTSW 14 67776300 missense probably damaging 1.00
R9244:Dock5 UTSW 14 67759114 missense probably damaging 0.99
R9345:Dock5 UTSW 14 67822622 missense possibly damaging 0.74
R9679:Dock5 UTSW 14 67781001 missense probably damaging 1.00
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAGACCTCAATGGACCTTCTCC -3'
(R):5'- TCCCAGGTAACCACTGTTTC -3'

Sequencing Primer
(F):5'- AGTGGTCTCATAATTCACCTCTAC -3'
(R):5'- AGGTAACCACTGTTTCCTTCTGTGG -3'
Posted On 2019-10-07