Mutagenetix > Incidental Mutations

Incidental Mutation 'R7423:Atg16l1'

575797

Institutional Source

Beutler Lab

Gene Symbol

Atg16l1

Ensembl Gene

ENSMUSG00000026289

Gene Name

autophagy related 16-like 1 (S. cerevisiae)

Synonyms

1500009K01Rik, APG16L, WDR30

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7423 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87755870-87792428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87786301 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 478 (V478A)

Ref Sequence

ENSEMBL: ENSMUSP00000108815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027512] [ENSMUST00000113186] [ENSMUST00000113190]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027512
AA Change: V462A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289
AA Change: V462A

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	1.3e-63	PFAM
low complexity region	237	246	N/A	INTRINSIC
WD40	311	350	7.05e-9	SMART
WD40	355	394	7.28e-2	SMART
WD40	397	436	1.07e-8	SMART
WD40	439	475	3.7e0	SMART
WD40	478	516	5.35e-1	SMART
WD40	519	562	1.2e-2	SMART
WD40	565	605	6.89e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113186
AA Change: V443A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289
AA Change: V443A

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	3.7e-64	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
WD40	292	331	7.05e-9	SMART
WD40	336	375	7.28e-2	SMART
WD40	378	417	1.07e-8	SMART
WD40	420	456	3.7e0	SMART
WD40	459	497	5.35e-1	SMART
WD40	500	543	1.2e-2	SMART
WD40	546	586	6.89e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113190
AA Change: V478A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289
AA Change: V478A

Domain	Start	End	E-Value	Type
Pfam:ATG16	16	206	6.5e-49	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
WD40	327	366	7.05e-9	SMART
WD40	371	410	7.28e-2	SMART
WD40	413	452	1.07e-8	SMART
WD40	455	491	3.7e0	SMART
WD40	494	532	5.35e-1	SMART
WD40	535	578	1.2e-2	SMART
WD40	581	621	6.89e-3	SMART

Meta Mutation Damage Score

0.5405

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

96% (91/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Null homozygotes have a cellular defect in autophagy that results in lethality during the neonatal starvation period. Mice homozygous for hypomorphic alleles have Paneth cells with aberrant, disorganized granules similar to those found in patients with Crohn's disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsbg2	A	T	17: 56,868,257	M85K	probably benign	Het
Actn4	C	T	7: 28,894,255	A905T	probably damaging	Het
Aff1	T	A	5: 103,847,101	V1055D	probably damaging	Het
AI481877	A	T	4: 59,076,264	S560T	probably benign	Het
Aox3	A	G	1: 58,121,069	E137G	possibly damaging	Het
Apaf1	A	T	10: 91,059,606	D443E	probably damaging	Het
Arl5b	C	A	2: 15,068,172	A28E	probably damaging	Het
Atp6v1f	G	C	6: 29,468,106	E13Q	probably null	Het
Atpaf1	A	T	4: 115,790,630	K162M	probably damaging	Het
C3	A	T	17: 57,214,767	L1100Q	probably damaging	Het
Ccr1	A	G	9: 123,964,385	L36P	probably damaging	Het
Cct3	T	C	3: 88,309,196	L153S	probably benign	Het
Chd4	A	G	6: 125,128,859	D1813G	possibly damaging	Het
Chrm3	T	C	13: 9,878,809	I64V	probably benign	Het
Cnot2	A	T	10: 116,492,398	V477E	probably damaging	Het
Csf2rb2	T	A	15: 78,292,560	I211F	possibly damaging	Het
Dnah8	T	C	17: 30,704,769	L1237P	possibly damaging	Het
Dnttip2	T	C	3: 122,275,526	V130A	probably benign	Het
Dock10	G	A	1: 80,523,780	A1852V	possibly damaging	Het
Dock3	A	G	9: 106,967,171	V910A	probably damaging	Het
Fbrs	G	A	7: 127,489,461	W738*	probably null	Het
Fmnl3	T	A	15: 99,329,400	D162V	probably damaging	Het
Fosl2	A	G	5: 32,150,463	R133G	probably damaging	Het
Frmpd1	A	G	4: 45,256,948	Q172R	probably damaging	Het
Fsd1l	A	T	4: 53,686,406	D273V	probably damaging	Het
Fstl4	T	A	11: 53,068,555	M141K	possibly damaging	Het
Gcfc2	A	G	6: 81,946,560	D535G	probably damaging	Het
Gm19410	A	C	8: 35,804,607	D1277A	probably benign	Het
Gnmt	T	A	17: 46,726,140	N211Y	probably damaging	Het
Hic2	A	G	16: 17,258,129	D274G	probably damaging	Het
Hnrnpu	A	G	1: 178,329,284		probably benign	Het
Icam5	T	C	9: 21,036,905	S670P	probably benign	Het
Ighv5-4	A	T	12: 113,597,500	L100Q	probably damaging	Het
Il17rb	A	T	14: 29,997,115	S337T	probably damaging	Het
Inf2	G	T	12: 112,609,738	R883L	unknown	Het
Inhbc	C	T	10: 127,357,406	C247Y	probably damaging	Het
Ints4	A	G	7: 97,507,719	K333E	probably damaging	Het
Iyd	A	T	10: 3,547,088	I148F	probably damaging	Het
Klk1b26	A	T	7: 44,014,769	D16V	probably damaging	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Lama2	A	T	10: 27,212,226	S852T	probably benign	Het
Mbtd1	A	G	11: 93,943,796	E600G	probably benign	Het
Mfap3	T	G	11: 57,529,503	N103K	probably damaging	Het
Mtor	G	A	4: 148,556,344	E2536K	possibly damaging	Het
Mug2	G	A	6: 122,079,726	S1210N	probably benign	Het
Nat8	G	A	6: 85,830,495	L219F	probably benign	Het
Nisch	A	G	14: 31,171,701	V1305A	probably benign	Het
Nup153	A	T	13: 46,696,644		probably null	Het
Olfr401	G	A	11: 74,121,985	R232H	probably benign	Het
Otud6b	A	T	4: 14,825,858		probably null	Het
Pbld2	A	G	10: 63,048,004	T83A	probably damaging	Het
Pcx	A	T	19: 4,621,178	M1144L	probably benign	Het
Pdpk1	C	A	17: 24,110,900	R81L	probably benign	Het
Pik3cd	A	T	4: 149,651,763		probably null	Het
Plch2	A	C	4: 154,983,737	D1477E	probably damaging	Het
Plek2	A	G	12: 78,900,110	I51T	probably damaging	Het
Plekhn1	A	G	4: 156,230,685	V505A	probably benign	Het
Pofut2	T	C	10: 77,262,439	S129P	possibly damaging	Het
Prdx5	C	A	19: 6,910,002		probably benign	Het
Proca1	G	T	11: 78,194,817		probably benign	Het
Prrxl1	A	G	14: 32,628,821	S205G	probably damaging	Het
Ptprs	A	C	17: 56,414,793	Y1752D	probably damaging	Het
Pum1	G	A	4: 130,774,545	V1127M	probably damaging	Het
Ralbp1	T	C	17: 65,858,981	R403G	probably damaging	Het
Reps1	A	T	10: 18,093,887	H246L	possibly damaging	Het
Rps6kc1	A	C	1: 190,799,096	M903R	probably damaging	Het
Rubcnl	A	G	14: 75,049,643	T584A	probably benign	Het
Samd9l	A	T	6: 3,374,408	V951E	probably damaging	Het
Sbf2	A	G	7: 110,438,848	F463L	possibly damaging	Het
Sdr16c6	G	A	4: 4,076,921		probably benign	Het
Slc26a8	A	G	17: 28,648,203	I548T	probably benign	Het
Slc2a13	T	A	15: 91,572,680	I140F	probably damaging	Het
Smtn	A	T	11: 3,531,200		probably null	Het
Sobp	G	T	10: 43,022,568	C340*	probably null	Het
Sox6	A	T	7: 115,550,023	V413E	probably benign	Het
Spin1	T	C	13: 51,123,290		probably null	Het
Sra1	T	C	18: 36,667,483	T224A	probably benign	Het
Sv2c	A	T	13: 96,048,548	F207Y	probably benign	Het
Tcp10c	T	A	17: 13,361,241		probably null	Het
Tcrg-V6	G	T	13: 19,190,644	G40W	possibly damaging	Het
Tkt	G	A	14: 30,571,035	G490S	possibly damaging	Het
Tpgs1	G	T	10: 79,675,821	A266S	probably damaging	Het
Tprg	T	G	16: 25,422,253	S260A	probably damaging	Het
Trdv2-1	T	A	14: 53,946,478	W56R	probably damaging	Het
Trpc4	T	A	3: 54,318,029	V933E	probably benign	Het
Ulk4	A	T	9: 121,103,621	M1051K	possibly damaging	Het
Unc119b	A	G	5: 115,134,684	L76P	probably damaging	Het
Vmn2r15	G	A	5: 109,297,528	S10F	probably benign	Het
Vwce	A	G	19: 10,664,340	E810G	probably benign	Het
Wdr7	T	A	18: 63,777,380		probably null	Het
Wnk2	T	A	13: 49,038,132	E1283V	probably benign	Het
Zfp28	T	C	7: 6,393,957	C464R	probably damaging	Het
Zpld1	C	T	16: 55,233,664	C255Y	probably damaging	Het

Other mutations in Atg16l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Atg16l1	APN	1	87765397	missense	possibly damaging	0.68
IGL00861:Atg16l1	APN	1	87774838	missense	probably damaging	1.00
IGL01065:Atg16l1	APN	1	87785931	missense	probably damaging	0.99
IGL01068:Atg16l1	APN	1	87774824	missense	probably damaging	1.00
IGL01140:Atg16l1	APN	1	87774853	missense	probably benign	0.03
R0023:Atg16l1	UTSW	1	87789465	missense	probably benign	0.00
R0023:Atg16l1	UTSW	1	87789465	missense	probably benign	0.00
R0650:Atg16l1	UTSW	1	87781699	missense	possibly damaging	0.93
R0655:Atg16l1	UTSW	1	87766829	missense	probably damaging	1.00
R1421:Atg16l1	UTSW	1	87786358	splice site	probably benign
R1549:Atg16l1	UTSW	1	87774188	missense	probably benign
R2202:Atg16l1	UTSW	1	87767015	missense	probably benign	0.03
R2204:Atg16l1	UTSW	1	87767015	missense	probably benign	0.03
R3689:Atg16l1	UTSW	1	87785904	missense	probably damaging	1.00
R4012:Atg16l1	UTSW	1	87766907	missense	probably damaging	1.00
R4391:Atg16l1	UTSW	1	87760120	missense	probably damaging	0.97
R4839:Atg16l1	UTSW	1	87766174	missense	probably damaging	0.99
R4935:Atg16l1	UTSW	1	87767042	missense	possibly damaging	0.69
R4980:Atg16l1	UTSW	1	87766831	missense	possibly damaging	0.89
R4990:Atg16l1	UTSW	1	87789369	missense	probably benign	0.00
R5011:Atg16l1	UTSW	1	87774180	nonsense	probably null
R5457:Atg16l1	UTSW	1	87775091	missense	probably damaging	0.96
R5897:Atg16l1	UTSW	1	87785997	critical splice donor site	probably null
R6289:Atg16l1	UTSW	1	87756215	missense	probably damaging	0.99
R6437:Atg16l1	UTSW	1	87790648	missense	probably damaging	1.00
R6727:Atg16l1	UTSW	1	87774854	missense	possibly damaging	0.68
R6923:Atg16l1	UTSW	1	87774356	splice site	probably null
R7475:Atg16l1	UTSW	1	87760083	missense	possibly damaging	0.89
R8493:Atg16l1	UTSW	1	87778982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCAGTCTGAGGAGCGCTG -3'
(R):5'- TAAATGACGCTGGACCCAG -3'

Sequencing Primer
(F):5'- CTGCTTGAGGTCTCATTTCATTTTG -3'
(R):5'- GCTGGACCCAGAAGACTACTTTG -3'

Posted On

2019-10-07