Incidental Mutation 'R7423:Gcfc2'
ID575819
Institutional Source Beutler Lab
Gene Symbol Gcfc2
Ensembl Gene ENSMUSG00000035125
Gene NameGC-rich sequence DNA binding factor 2
SynonymsAW146020
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.527) question?
Stock #R7423 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location81923669-81959915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81946560 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 535 (D535G)
Ref Sequence ENSEMBL: ENSMUSP00000035644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043195] [ENSMUST00000152996]
Predicted Effect probably damaging
Transcript: ENSMUST00000043195
AA Change: D535G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125
AA Change: D535G

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
coiled coil region 255 308 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
Pfam:GCFC 456 672 3e-34 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152996
SMART Domains Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
Predicted Effect
Meta Mutation Damage Score 0.9446 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The first mRNA transcript isolated for this gene was part of an artificial chimera derived from two distinct gene transcripts and a primer used in the cloning process (see Genbank accession M29204). A positively charged amino terminus present only in the chimera was determined to bind GC-rich DNA, thus mistakenly thought to identify a transcription factor gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A T 17: 56,868,257 M85K probably benign Het
Actn4 C T 7: 28,894,255 A905T probably damaging Het
Aff1 T A 5: 103,847,101 V1055D probably damaging Het
AI481877 A T 4: 59,076,264 S560T probably benign Het
Aox3 A G 1: 58,121,069 E137G possibly damaging Het
Apaf1 A T 10: 91,059,606 D443E probably damaging Het
Arl5b C A 2: 15,068,172 A28E probably damaging Het
Atg16l1 T C 1: 87,786,301 V478A probably damaging Het
Atp6v1f G C 6: 29,468,106 E13Q probably null Het
Atpaf1 A T 4: 115,790,630 K162M probably damaging Het
C3 A T 17: 57,214,767 L1100Q probably damaging Het
Ccr1 A G 9: 123,964,385 L36P probably damaging Het
Cct3 T C 3: 88,309,196 L153S probably benign Het
Chd4 A G 6: 125,128,859 D1813G possibly damaging Het
Chrm3 T C 13: 9,878,809 I64V probably benign Het
Cnot2 A T 10: 116,492,398 V477E probably damaging Het
Csf2rb2 T A 15: 78,292,560 I211F possibly damaging Het
Dnah8 T C 17: 30,704,769 L1237P possibly damaging Het
Dnttip2 T C 3: 122,275,526 V130A probably benign Het
Dock10 G A 1: 80,523,780 A1852V possibly damaging Het
Dock3 A G 9: 106,967,171 V910A probably damaging Het
Fbrs G A 7: 127,489,461 W738* probably null Het
Fmnl3 T A 15: 99,329,400 D162V probably damaging Het
Fosl2 A G 5: 32,150,463 R133G probably damaging Het
Frmpd1 A G 4: 45,256,948 Q172R probably damaging Het
Fsd1l A T 4: 53,686,406 D273V probably damaging Het
Fstl4 T A 11: 53,068,555 M141K possibly damaging Het
Gm19410 A C 8: 35,804,607 D1277A probably benign Het
Gnmt T A 17: 46,726,140 N211Y probably damaging Het
Hic2 A G 16: 17,258,129 D274G probably damaging Het
Hnrnpu A G 1: 178,329,284 probably benign Het
Icam5 T C 9: 21,036,905 S670P probably benign Het
Ighv5-4 A T 12: 113,597,500 L100Q probably damaging Het
Il17rb A T 14: 29,997,115 S337T probably damaging Het
Inf2 G T 12: 112,609,738 R883L unknown Het
Inhbc C T 10: 127,357,406 C247Y probably damaging Het
Ints4 A G 7: 97,507,719 K333E probably damaging Het
Iyd A T 10: 3,547,088 I148F probably damaging Het
Klk1b26 A T 7: 44,014,769 D16V probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lama2 A T 10: 27,212,226 S852T probably benign Het
Mbtd1 A G 11: 93,943,796 E600G probably benign Het
Mfap3 T G 11: 57,529,503 N103K probably damaging Het
Mtor G A 4: 148,556,344 E2536K possibly damaging Het
Mug2 G A 6: 122,079,726 S1210N probably benign Het
Nat8 G A 6: 85,830,495 L219F probably benign Het
Nisch A G 14: 31,171,701 V1305A probably benign Het
Nup153 A T 13: 46,696,644 probably null Het
Olfr401 G A 11: 74,121,985 R232H probably benign Het
Otud6b A T 4: 14,825,858 probably null Het
Pbld2 A G 10: 63,048,004 T83A probably damaging Het
Pcx A T 19: 4,621,178 M1144L probably benign Het
Pdpk1 C A 17: 24,110,900 R81L probably benign Het
Pik3cd A T 4: 149,651,763 probably null Het
Plch2 A C 4: 154,983,737 D1477E probably damaging Het
Plek2 A G 12: 78,900,110 I51T probably damaging Het
Plekhn1 A G 4: 156,230,685 V505A probably benign Het
Pofut2 T C 10: 77,262,439 S129P possibly damaging Het
Prdx5 C A 19: 6,910,002 probably benign Het
Proca1 G T 11: 78,194,817 probably benign Het
Prrxl1 A G 14: 32,628,821 S205G probably damaging Het
Ptprs A C 17: 56,414,793 Y1752D probably damaging Het
Pum1 G A 4: 130,774,545 V1127M probably damaging Het
Ralbp1 T C 17: 65,858,981 R403G probably damaging Het
Reps1 A T 10: 18,093,887 H246L possibly damaging Het
Rps6kc1 A C 1: 190,799,096 M903R probably damaging Het
Rubcnl A G 14: 75,049,643 T584A probably benign Het
Samd9l A T 6: 3,374,408 V951E probably damaging Het
Sbf2 A G 7: 110,438,848 F463L possibly damaging Het
Sdr16c6 G A 4: 4,076,921 probably benign Het
Slc26a8 A G 17: 28,648,203 I548T probably benign Het
Slc2a13 T A 15: 91,572,680 I140F probably damaging Het
Smtn A T 11: 3,531,200 probably null Het
Sobp G T 10: 43,022,568 C340* probably null Het
Sox6 A T 7: 115,550,023 V413E probably benign Het
Spin1 T C 13: 51,123,290 probably null Het
Sra1 T C 18: 36,667,483 T224A probably benign Het
Sv2c A T 13: 96,048,548 F207Y probably benign Het
Tcp10c T A 17: 13,361,241 probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tkt G A 14: 30,571,035 G490S possibly damaging Het
Tpgs1 G T 10: 79,675,821 A266S probably damaging Het
Tprg T G 16: 25,422,253 S260A probably damaging Het
Trdv2-1 T A 14: 53,946,478 W56R probably damaging Het
Trpc4 T A 3: 54,318,029 V933E probably benign Het
Ulk4 A T 9: 121,103,621 M1051K possibly damaging Het
Unc119b A G 5: 115,134,684 L76P probably damaging Het
Vmn2r15 G A 5: 109,297,528 S10F probably benign Het
Vwce A G 19: 10,664,340 E810G probably benign Het
Wdr7 T A 18: 63,777,380 probably null Het
Wnk2 T A 13: 49,038,132 E1283V probably benign Het
Zfp28 T C 7: 6,393,957 C464R probably damaging Het
Zpld1 C T 16: 55,233,664 C255Y probably damaging Het
Other mutations in Gcfc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Gcfc2 APN 6 81936015 missense probably damaging 0.99
IGL00473:Gcfc2 APN 6 81944374 missense probably damaging 1.00
IGL00497:Gcfc2 APN 6 81957970 missense probably benign 0.08
IGL02135:Gcfc2 APN 6 81941400 missense probably damaging 1.00
R0138:Gcfc2 UTSW 6 81949954 missense probably damaging 1.00
R0208:Gcfc2 UTSW 6 81943463 missense probably null 0.91
R0467:Gcfc2 UTSW 6 81923882 missense possibly damaging 0.56
R1105:Gcfc2 UTSW 6 81939453 missense probably damaging 1.00
R1521:Gcfc2 UTSW 6 81923812 missense probably benign 0.14
R1602:Gcfc2 UTSW 6 81944420 missense probably damaging 1.00
R1846:Gcfc2 UTSW 6 81956892 missense probably damaging 0.99
R2091:Gcfc2 UTSW 6 81943479 missense probably damaging 1.00
R2110:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2111:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2112:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2892:Gcfc2 UTSW 6 81956913 missense possibly damaging 0.87
R3792:Gcfc2 UTSW 6 81930767 missense probably benign 0.00
R4284:Gcfc2 UTSW 6 81941391 missense probably damaging 1.00
R4304:Gcfc2 UTSW 6 81943007 missense probably damaging 1.00
R4691:Gcfc2 UTSW 6 81941427 nonsense probably null
R5046:Gcfc2 UTSW 6 81948335 missense probably benign 0.12
R5233:Gcfc2 UTSW 6 81953290 missense probably damaging 1.00
R5307:Gcfc2 UTSW 6 81944386 missense probably damaging 0.97
R5308:Gcfc2 UTSW 6 81943543 critical splice donor site probably null
R5929:Gcfc2 UTSW 6 81946599 missense probably damaging 1.00
R6339:Gcfc2 UTSW 6 81946496 missense probably damaging 1.00
R6485:Gcfc2 UTSW 6 81939547 missense probably damaging 1.00
R6931:Gcfc2 UTSW 6 81942985 missense probably benign 0.36
R6948:Gcfc2 UTSW 6 81933753 missense probably benign 0.01
R7392:Gcfc2 UTSW 6 81943012 critical splice donor site probably null
R7509:Gcfc2 UTSW 6 81953275 missense probably damaging 1.00
R7713:Gcfc2 UTSW 6 81941390 missense probably damaging 1.00
R8089:Gcfc2 UTSW 6 81925790 missense probably damaging 1.00
R8249:Gcfc2 UTSW 6 81956951 missense probably benign 0.02
R8366:Gcfc2 UTSW 6 81923801 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTCTTTGAGCCTTAGGGAAAGTC -3'
(R):5'- TTCAAATACTACCACTACTGCTGTG -3'

Sequencing Primer
(F):5'- AGCCTTAGGGAAAGTCTAGGGATTTC -3'
(R):5'- TGGACAGCCAACAATTGTGC -3'
Posted On2019-10-07