Incidental Mutation 'R7423:Dock3'
ID575832
Institutional Source Beutler Lab
Gene Symbol Dock3
Ensembl Gene ENSMUSG00000039716
Gene Namededicator of cyto-kinesis 3
SynonymsPBP, Moca
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R7423 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location106892825-107231909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106967171 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 910 (V910A)
Ref Sequence ENSEMBL: ENSMUSP00000047652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044532]
Predicted Effect probably damaging
Transcript: ENSMUST00000044532
AA Change: V910A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: V910A

DomainStartEndE-ValueType
SH3 9 66 3.85e-9 SMART
Pfam:DOCK_N 69 412 1.4e-120 PFAM
Pfam:DOCK-C2 417 608 7.7e-56 PFAM
low complexity region 854 867 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
Pfam:DHR-2 1121 1628 9e-133 PFAM
low complexity region 1679 1690 N/A INTRINSIC
low complexity region 1693 1704 N/A INTRINSIC
low complexity region 1730 1754 N/A INTRINSIC
low complexity region 1880 1902 N/A INTRINSIC
low complexity region 1963 1977 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000130873
Gene: ENSMUSG00000039716
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A T 17: 56,868,257 M85K probably benign Het
Actn4 C T 7: 28,894,255 A905T probably damaging Het
Aff1 T A 5: 103,847,101 V1055D probably damaging Het
AI481877 A T 4: 59,076,264 S560T probably benign Het
Aox3 A G 1: 58,121,069 E137G possibly damaging Het
Apaf1 A T 10: 91,059,606 D443E probably damaging Het
Arl5b C A 2: 15,068,172 A28E probably damaging Het
Atg16l1 T C 1: 87,786,301 V478A probably damaging Het
Atp6v1f G C 6: 29,468,106 E13Q probably null Het
Atpaf1 A T 4: 115,790,630 K162M probably damaging Het
C3 A T 17: 57,214,767 L1100Q probably damaging Het
Ccr1 A G 9: 123,964,385 L36P probably damaging Het
Cct3 T C 3: 88,309,196 L153S probably benign Het
Chd4 A G 6: 125,128,859 D1813G possibly damaging Het
Chrm3 T C 13: 9,878,809 I64V probably benign Het
Cnot2 A T 10: 116,492,398 V477E probably damaging Het
Csf2rb2 T A 15: 78,292,560 I211F possibly damaging Het
Dnah8 T C 17: 30,704,769 L1237P possibly damaging Het
Dnttip2 T C 3: 122,275,526 V130A probably benign Het
Dock10 G A 1: 80,523,780 A1852V possibly damaging Het
Fbrs G A 7: 127,489,461 W738* probably null Het
Fmnl3 T A 15: 99,329,400 D162V probably damaging Het
Fosl2 A G 5: 32,150,463 R133G probably damaging Het
Frmpd1 A G 4: 45,256,948 Q172R probably damaging Het
Fsd1l A T 4: 53,686,406 D273V probably damaging Het
Fstl4 T A 11: 53,068,555 M141K possibly damaging Het
Gcfc2 A G 6: 81,946,560 D535G probably damaging Het
Gm19410 A C 8: 35,804,607 D1277A probably benign Het
Gnmt T A 17: 46,726,140 N211Y probably damaging Het
Hic2 A G 16: 17,258,129 D274G probably damaging Het
Hnrnpu A G 1: 178,329,284 probably benign Het
Icam5 T C 9: 21,036,905 S670P probably benign Het
Ighv5-4 A T 12: 113,597,500 L100Q probably damaging Het
Il17rb A T 14: 29,997,115 S337T probably damaging Het
Inf2 G T 12: 112,609,738 R883L unknown Het
Inhbc C T 10: 127,357,406 C247Y probably damaging Het
Ints4 A G 7: 97,507,719 K333E probably damaging Het
Iyd A T 10: 3,547,088 I148F probably damaging Het
Klk1b26 A T 7: 44,014,769 D16V probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lama2 A T 10: 27,212,226 S852T probably benign Het
Mbtd1 A G 11: 93,943,796 E600G probably benign Het
Mfap3 T G 11: 57,529,503 N103K probably damaging Het
Mtor G A 4: 148,556,344 E2536K possibly damaging Het
Mug2 G A 6: 122,079,726 S1210N probably benign Het
Nat8 G A 6: 85,830,495 L219F probably benign Het
Nisch A G 14: 31,171,701 V1305A probably benign Het
Nup153 A T 13: 46,696,644 probably null Het
Olfr401 G A 11: 74,121,985 R232H probably benign Het
Otud6b A T 4: 14,825,858 probably null Het
Pbld2 A G 10: 63,048,004 T83A probably damaging Het
Pcx A T 19: 4,621,178 M1144L probably benign Het
Pdpk1 C A 17: 24,110,900 R81L probably benign Het
Pik3cd A T 4: 149,651,763 probably null Het
Plch2 A C 4: 154,983,737 D1477E probably damaging Het
Plek2 A G 12: 78,900,110 I51T probably damaging Het
Plekhn1 A G 4: 156,230,685 V505A probably benign Het
Pofut2 T C 10: 77,262,439 S129P possibly damaging Het
Prdx5 C A 19: 6,910,002 probably benign Het
Proca1 G T 11: 78,194,817 probably benign Het
Prrxl1 A G 14: 32,628,821 S205G probably damaging Het
Ptprs A C 17: 56,414,793 Y1752D probably damaging Het
Pum1 G A 4: 130,774,545 V1127M probably damaging Het
Ralbp1 T C 17: 65,858,981 R403G probably damaging Het
Reps1 A T 10: 18,093,887 H246L possibly damaging Het
Rps6kc1 A C 1: 190,799,096 M903R probably damaging Het
Rubcnl A G 14: 75,049,643 T584A probably benign Het
Samd9l A T 6: 3,374,408 V951E probably damaging Het
Sbf2 A G 7: 110,438,848 F463L possibly damaging Het
Sdr16c6 G A 4: 4,076,921 probably benign Het
Slc26a8 A G 17: 28,648,203 I548T probably benign Het
Slc2a13 T A 15: 91,572,680 I140F probably damaging Het
Smtn A T 11: 3,531,200 probably null Het
Sobp G T 10: 43,022,568 C340* probably null Het
Sox6 A T 7: 115,550,023 V413E probably benign Het
Spin1 T C 13: 51,123,290 probably null Het
Sra1 T C 18: 36,667,483 T224A probably benign Het
Sv2c A T 13: 96,048,548 F207Y probably benign Het
Tcp10c T A 17: 13,361,241 probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tkt G A 14: 30,571,035 G490S possibly damaging Het
Tpgs1 G T 10: 79,675,821 A266S probably damaging Het
Tprg T G 16: 25,422,253 S260A probably damaging Het
Trdv2-1 T A 14: 53,946,478 W56R probably damaging Het
Trpc4 T A 3: 54,318,029 V933E probably benign Het
Ulk4 A T 9: 121,103,621 M1051K possibly damaging Het
Unc119b A G 5: 115,134,684 L76P probably damaging Het
Vmn2r15 G A 5: 109,297,528 S10F probably benign Het
Vwce A G 19: 10,664,340 E810G probably benign Het
Wdr7 T A 18: 63,777,380 probably null Het
Wnk2 T A 13: 49,038,132 E1283V probably benign Het
Zfp28 T C 7: 6,393,957 C464R probably damaging Het
Zpld1 C T 16: 55,233,664 C255Y probably damaging Het
Other mutations in Dock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Dock3 APN 9 106911377 splice site probably benign
IGL01067:Dock3 APN 9 107082373 critical splice donor site probably null
IGL01160:Dock3 APN 9 106906688 missense probably damaging 1.00
IGL01290:Dock3 APN 9 106958400 splice site probably benign
IGL01291:Dock3 APN 9 106958400 splice site probably benign
IGL01391:Dock3 APN 9 106907234 missense possibly damaging 0.55
IGL01399:Dock3 APN 9 106993471 missense probably benign 0.06
IGL01660:Dock3 APN 9 107032364 splice site probably benign
IGL01752:Dock3 APN 9 107025313 splice site probably benign
IGL01820:Dock3 APN 9 106895893 missense probably damaging 1.00
IGL01908:Dock3 APN 9 106906662 missense possibly damaging 0.81
IGL02191:Dock3 APN 9 106938141 missense probably benign
IGL02227:Dock3 APN 9 107062055 missense probably damaging 0.98
IGL02309:Dock3 APN 9 106913152 missense probably damaging 1.00
IGL02408:Dock3 APN 9 106913099 splice site probably benign
IGL02469:Dock3 APN 9 106986016 missense probably damaging 0.98
IGL02545:Dock3 APN 9 107062072 missense probably damaging 1.00
IGL02894:Dock3 APN 9 106930099 missense probably benign 0.00
IGL02934:Dock3 APN 9 107023745 missense probably benign 0.01
IGL03027:Dock3 APN 9 106993478 missense probably damaging 0.98
IGL03068:Dock3 APN 9 106964759 missense possibly damaging 0.82
IGL03128:Dock3 APN 9 107032292 missense probably benign 0.05
IGL03161:Dock3 APN 9 107023788 missense probably damaging 0.99
IGL03263:Dock3 APN 9 106930131 splice site probably benign
IGL03279:Dock3 APN 9 106911248 splice site probably benign
IGL03366:Dock3 APN 9 107005433 missense probably benign 0.01
Implosion UTSW 9 106937926 missense probably benign 0.00
Squeeze UTSW 9 106930043 missense probably damaging 1.00
Tight UTSW 9 106994881 missense probably damaging 1.00
ANU05:Dock3 UTSW 9 106895663 missense probably benign
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0030:Dock3 UTSW 9 106912313 missense possibly damaging 0.64
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0206:Dock3 UTSW 9 106996996 nonsense probably null
R0208:Dock3 UTSW 9 106996996 nonsense probably null
R0384:Dock3 UTSW 9 106901895 splice site probably benign
R0610:Dock3 UTSW 9 107023788 missense probably damaging 0.99
R0731:Dock3 UTSW 9 106969856 missense probably damaging 1.00
R1184:Dock3 UTSW 9 106969800 missense probably damaging 1.00
R1350:Dock3 UTSW 9 106914632 missense possibly damaging 0.52
R1393:Dock3 UTSW 9 106911349 missense probably damaging 1.00
R1424:Dock3 UTSW 9 106913193 missense probably damaging 1.00
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1539:Dock3 UTSW 9 106952364 missense probably damaging 1.00
R1539:Dock3 UTSW 9 106996913 missense probably benign 0.23
R1571:Dock3 UTSW 9 106937959 missense possibly damaging 0.92
R1682:Dock3 UTSW 9 106973841 missense probably damaging 0.98
R1795:Dock3 UTSW 9 107025335 missense probably damaging 0.99
R1987:Dock3 UTSW 9 107108421 missense probably benign 0.01
R2000:Dock3 UTSW 9 106992961 splice site probably benign
R2074:Dock3 UTSW 9 106993463 missense possibly damaging 0.46
R2114:Dock3 UTSW 9 106993544 missense probably benign 0.00
R2265:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2269:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2370:Dock3 UTSW 9 106952355 missense probably damaging 1.00
R2377:Dock3 UTSW 9 106895891 missense probably damaging 0.98
R2385:Dock3 UTSW 9 106991125 missense probably damaging 1.00
R2426:Dock3 UTSW 9 106914541 missense possibly damaging 0.76
R3076:Dock3 UTSW 9 106941526 critical splice acceptor site probably null
R3122:Dock3 UTSW 9 106911343 missense probably damaging 0.99
R4052:Dock3 UTSW 9 106973796 missense probably damaging 0.99
R4294:Dock3 UTSW 9 106930043 missense probably damaging 1.00
R4623:Dock3 UTSW 9 107062045 missense possibly damaging 0.61
R4664:Dock3 UTSW 9 106993544 missense possibly damaging 0.71
R4705:Dock3 UTSW 9 107025336 missense probably damaging 1.00
R4771:Dock3 UTSW 9 106952358 missense possibly damaging 0.89
R4898:Dock3 UTSW 9 106930067 missense probably damaging 1.00
R4898:Dock3 UTSW 9 106992972 missense possibly damaging 0.75
R4948:Dock3 UTSW 9 106991155 missense probably damaging 0.96
R4961:Dock3 UTSW 9 106941316 missense probably damaging 1.00
R4986:Dock3 UTSW 9 106931983 missense probably damaging 1.00
R5054:Dock3 UTSW 9 106937906 missense probably damaging 1.00
R5065:Dock3 UTSW 9 106955684 missense probably damaging 1.00
R5081:Dock3 UTSW 9 106991093 missense probably damaging 1.00
R5101:Dock3 UTSW 9 106969781 missense probably damaging 1.00
R5135:Dock3 UTSW 9 106932997 missense probably damaging 1.00
R5227:Dock3 UTSW 9 106986070 missense probably damaging 1.00
R5257:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5258:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5273:Dock3 UTSW 9 106900705 critical splice donor site probably null
R5322:Dock3 UTSW 9 106901829 missense probably benign 0.14
R5482:Dock3 UTSW 9 106978738 nonsense probably null
R5553:Dock3 UTSW 9 106991110 missense possibly damaging 0.81
R5631:Dock3 UTSW 9 106955699 missense probably benign 0.01
R5739:Dock3 UTSW 9 106973796 missense possibly damaging 0.92
R5838:Dock3 UTSW 9 106895488 missense possibly damaging 0.51
R5888:Dock3 UTSW 9 107023803 missense probably benign 0.12
R5960:Dock3 UTSW 9 106911355 nonsense probably null
R5974:Dock3 UTSW 9 106994062 missense probably damaging 1.00
R6116:Dock3 UTSW 9 106931962 missense probably damaging 1.00
R6162:Dock3 UTSW 9 106964799 missense possibly damaging 0.88
R6176:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6219:Dock3 UTSW 9 106994881 missense probably damaging 1.00
R6238:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6266:Dock3 UTSW 9 106964753 missense probably damaging 0.99
R6291:Dock3 UTSW 9 106908432 missense probably benign
R6531:Dock3 UTSW 9 106967216 missense probably benign
R6567:Dock3 UTSW 9 106896747 missense probably benign 0.13
R6572:Dock3 UTSW 9 106989475 missense probably damaging 0.99
R6620:Dock3 UTSW 9 106937926 missense probably benign 0.00
R6726:Dock3 UTSW 9 107159452 nonsense probably null
R7085:Dock3 UTSW 9 106901887 missense probably damaging 1.00
R7151:Dock3 UTSW 9 106964717 missense possibly damaging 0.68
R7320:Dock3 UTSW 9 106895524 missense probably benign 0.20
R7357:Dock3 UTSW 9 107005369 missense probably benign 0.34
R7426:Dock3 UTSW 9 106895583 missense probably benign
R7439:Dock3 UTSW 9 107023732 missense probably damaging 1.00
R7452:Dock3 UTSW 9 106989465 missense probably damaging 1.00
R7470:Dock3 UTSW 9 107005445 missense probably damaging 1.00
R7879:Dock3 UTSW 9 106908501 missense probably benign 0.05
R8047:Dock3 UTSW 9 106993009 missense possibly damaging 0.93
R8308:Dock3 UTSW 9 106913172 missense probably benign 0.00
X0023:Dock3 UTSW 9 106985998 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAACGTGCTGACCATCATGC -3'
(R):5'- CCCTTCACAGTCCATGTTGGTG -3'

Sequencing Primer
(F):5'- TGCTGACCATCATGCAGGGAG -3'
(R):5'- CCATGTTGGTGAGTCTACAAGATCAG -3'
Posted On2019-10-07