Incidental Mutation 'R7423:Ulk4'
ID575833
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Nameunc-51-like kinase 4
Synonyms4932415A06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R7423 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location120955351-121277197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121103621 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1051 (M1051K)
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051479
AA Change: M1051K

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: M1051K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171061
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171923
AA Change: M1051K

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: M1051K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A T 17: 56,868,257 M85K probably benign Het
Actn4 C T 7: 28,894,255 A905T probably damaging Het
Aff1 T A 5: 103,847,101 V1055D probably damaging Het
AI481877 A T 4: 59,076,264 S560T probably benign Het
Aox3 A G 1: 58,121,069 E137G possibly damaging Het
Apaf1 A T 10: 91,059,606 D443E probably damaging Het
Arl5b C A 2: 15,068,172 A28E probably damaging Het
Atg16l1 T C 1: 87,786,301 V478A probably damaging Het
Atp6v1f G C 6: 29,468,106 E13Q probably null Het
Atpaf1 A T 4: 115,790,630 K162M probably damaging Het
C3 A T 17: 57,214,767 L1100Q probably damaging Het
Ccr1 A G 9: 123,964,385 L36P probably damaging Het
Cct3 T C 3: 88,309,196 L153S probably benign Het
Chd4 A G 6: 125,128,859 D1813G possibly damaging Het
Chrm3 T C 13: 9,878,809 I64V probably benign Het
Cnot2 A T 10: 116,492,398 V477E probably damaging Het
Csf2rb2 T A 15: 78,292,560 I211F possibly damaging Het
Dnah8 T C 17: 30,704,769 L1237P possibly damaging Het
Dnttip2 T C 3: 122,275,526 V130A probably benign Het
Dock10 G A 1: 80,523,780 A1852V possibly damaging Het
Dock3 A G 9: 106,967,171 V910A probably damaging Het
Fbrs G A 7: 127,489,461 W738* probably null Het
Fmnl3 T A 15: 99,329,400 D162V probably damaging Het
Fosl2 A G 5: 32,150,463 R133G probably damaging Het
Frmpd1 A G 4: 45,256,948 Q172R probably damaging Het
Fsd1l A T 4: 53,686,406 D273V probably damaging Het
Fstl4 T A 11: 53,068,555 M141K possibly damaging Het
Gcfc2 A G 6: 81,946,560 D535G probably damaging Het
Gm19410 A C 8: 35,804,607 D1277A probably benign Het
Gnmt T A 17: 46,726,140 N211Y probably damaging Het
Hic2 A G 16: 17,258,129 D274G probably damaging Het
Hnrnpu A G 1: 178,329,284 probably benign Het
Icam5 T C 9: 21,036,905 S670P probably benign Het
Ighv5-4 A T 12: 113,597,500 L100Q probably damaging Het
Il17rb A T 14: 29,997,115 S337T probably damaging Het
Inf2 G T 12: 112,609,738 R883L unknown Het
Inhbc C T 10: 127,357,406 C247Y probably damaging Het
Ints4 A G 7: 97,507,719 K333E probably damaging Het
Iyd A T 10: 3,547,088 I148F probably damaging Het
Klk1b26 A T 7: 44,014,769 D16V probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lama2 A T 10: 27,212,226 S852T probably benign Het
Mbtd1 A G 11: 93,943,796 E600G probably benign Het
Mfap3 T G 11: 57,529,503 N103K probably damaging Het
Mtor G A 4: 148,556,344 E2536K possibly damaging Het
Mug2 G A 6: 122,079,726 S1210N probably benign Het
Nat8 G A 6: 85,830,495 L219F probably benign Het
Nisch A G 14: 31,171,701 V1305A probably benign Het
Nup153 A T 13: 46,696,644 probably null Het
Olfr401 G A 11: 74,121,985 R232H probably benign Het
Otud6b A T 4: 14,825,858 probably null Het
Pbld2 A G 10: 63,048,004 T83A probably damaging Het
Pcx A T 19: 4,621,178 M1144L probably benign Het
Pdpk1 C A 17: 24,110,900 R81L probably benign Het
Pik3cd A T 4: 149,651,763 probably null Het
Plch2 A C 4: 154,983,737 D1477E probably damaging Het
Plek2 A G 12: 78,900,110 I51T probably damaging Het
Plekhn1 A G 4: 156,230,685 V505A probably benign Het
Pofut2 T C 10: 77,262,439 S129P possibly damaging Het
Prdx5 C A 19: 6,910,002 probably benign Het
Proca1 G T 11: 78,194,817 probably benign Het
Prrxl1 A G 14: 32,628,821 S205G probably damaging Het
Ptprs A C 17: 56,414,793 Y1752D probably damaging Het
Pum1 G A 4: 130,774,545 V1127M probably damaging Het
Ralbp1 T C 17: 65,858,981 R403G probably damaging Het
Reps1 A T 10: 18,093,887 H246L possibly damaging Het
Rps6kc1 A C 1: 190,799,096 M903R probably damaging Het
Rubcnl A G 14: 75,049,643 T584A probably benign Het
Samd9l A T 6: 3,374,408 V951E probably damaging Het
Sbf2 A G 7: 110,438,848 F463L possibly damaging Het
Sdr16c6 G A 4: 4,076,921 probably benign Het
Slc26a8 A G 17: 28,648,203 I548T probably benign Het
Slc2a13 T A 15: 91,572,680 I140F probably damaging Het
Smtn A T 11: 3,531,200 probably null Het
Sobp G T 10: 43,022,568 C340* probably null Het
Sox6 A T 7: 115,550,023 V413E probably benign Het
Spin1 T C 13: 51,123,290 probably null Het
Sra1 T C 18: 36,667,483 T224A probably benign Het
Sv2c A T 13: 96,048,548 F207Y probably benign Het
Tcp10c T A 17: 13,361,241 probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tkt G A 14: 30,571,035 G490S possibly damaging Het
Tpgs1 G T 10: 79,675,821 A266S probably damaging Het
Tprg T G 16: 25,422,253 S260A probably damaging Het
Trdv2-1 T A 14: 53,946,478 W56R probably damaging Het
Trpc4 T A 3: 54,318,029 V933E probably benign Het
Unc119b A G 5: 115,134,684 L76P probably damaging Het
Vmn2r15 G A 5: 109,297,528 S10F probably benign Het
Vwce A G 19: 10,664,340 E810G probably benign Het
Wdr7 T A 18: 63,777,380 probably null Het
Wnk2 T A 13: 49,038,132 E1283V probably benign Het
Zfp28 T C 7: 6,393,957 C464R probably damaging Het
Zpld1 C T 16: 55,233,664 C255Y probably damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTCAGTTGATGGCTAAGAC -3'
(R):5'- TCTGGTAAGATGCTGGCAAGG -3'

Sequencing Primer
(F):5'- GATGGCTAAGACTTACTTTGGAGATC -3'
(R):5'- TGCTGGCAAGGGGAGTG -3'
Posted On2019-10-07