Incidental Mutation 'R7423:Apaf1'
ID575842
Institutional Source Beutler Lab
Gene Symbol Apaf1
Ensembl Gene ENSMUSG00000019979
Gene Nameapoptotic peptidase activating factor 1
SynonymsApaf1l, 6230400I06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7423 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location90989311-91082770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91059606 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 443 (D443E)
Ref Sequence ENSEMBL: ENSMUSP00000020157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000162618]
Predicted Effect probably damaging
Transcript: ENSMUST00000020157
AA Change: D443E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: D443E

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.3e-22 PFAM
Pfam:NB-ARC 129 414 1.7e-77 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159110
AA Change: D443E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: D443E

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.4e-21 PFAM
Pfam:NB-ARC 129 414 6.9e-71 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162618
AA Change: D432E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: D432E

DomainStartEndE-ValueType
Pfam:CARD 6 90 1.1e-20 PFAM
Pfam:NB-ARC 118 403 8.8e-72 PFAM
WD40 593 632 1.35e-5 SMART
WD40 635 674 1.04e-11 SMART
WD40 677 718 2.98e-7 SMART
WD40 721 760 9.88e-13 SMART
WD40 769 814 1.28e1 SMART
WD40 817 857 1.43e0 SMART
WD40 860 899 3.24e-8 SMART
WD40 941 978 2.57e0 SMART
WD40 981 1020 1.09e-5 SMART
WD40 1022 1060 2.09e-2 SMART
WD40 1063 1102 2.93e-6 SMART
WD40 1105 1144 8.55e-8 SMART
WD40 1157 1193 4.55e-3 SMART
Blast:WD40 1196 1235 5e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A T 17: 56,868,257 M85K probably benign Het
Actn4 C T 7: 28,894,255 A905T probably damaging Het
Aff1 T A 5: 103,847,101 V1055D probably damaging Het
AI481877 A T 4: 59,076,264 S560T probably benign Het
Aox3 A G 1: 58,121,069 E137G possibly damaging Het
Arl5b C A 2: 15,068,172 A28E probably damaging Het
Atg16l1 T C 1: 87,786,301 V478A probably damaging Het
Atp6v1f G C 6: 29,468,106 E13Q probably null Het
Atpaf1 A T 4: 115,790,630 K162M probably damaging Het
C3 A T 17: 57,214,767 L1100Q probably damaging Het
Ccr1 A G 9: 123,964,385 L36P probably damaging Het
Cct3 T C 3: 88,309,196 L153S probably benign Het
Chd4 A G 6: 125,128,859 D1813G possibly damaging Het
Chrm3 T C 13: 9,878,809 I64V probably benign Het
Cnot2 A T 10: 116,492,398 V477E probably damaging Het
Csf2rb2 T A 15: 78,292,560 I211F possibly damaging Het
Dnah8 T C 17: 30,704,769 L1237P possibly damaging Het
Dnttip2 T C 3: 122,275,526 V130A probably benign Het
Dock10 G A 1: 80,523,780 A1852V possibly damaging Het
Dock3 A G 9: 106,967,171 V910A probably damaging Het
Fbrs G A 7: 127,489,461 W738* probably null Het
Fmnl3 T A 15: 99,329,400 D162V probably damaging Het
Fosl2 A G 5: 32,150,463 R133G probably damaging Het
Frmpd1 A G 4: 45,256,948 Q172R probably damaging Het
Fsd1l A T 4: 53,686,406 D273V probably damaging Het
Fstl4 T A 11: 53,068,555 M141K possibly damaging Het
Gcfc2 A G 6: 81,946,560 D535G probably damaging Het
Gm19410 A C 8: 35,804,607 D1277A probably benign Het
Gnmt T A 17: 46,726,140 N211Y probably damaging Het
Hic2 A G 16: 17,258,129 D274G probably damaging Het
Hnrnpu A G 1: 178,329,284 probably benign Het
Icam5 T C 9: 21,036,905 S670P probably benign Het
Ighv5-4 A T 12: 113,597,500 L100Q probably damaging Het
Il17rb A T 14: 29,997,115 S337T probably damaging Het
Inf2 G T 12: 112,609,738 R883L unknown Het
Inhbc C T 10: 127,357,406 C247Y probably damaging Het
Ints4 A G 7: 97,507,719 K333E probably damaging Het
Iyd A T 10: 3,547,088 I148F probably damaging Het
Klk1b26 A T 7: 44,014,769 D16V probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lama2 A T 10: 27,212,226 S852T probably benign Het
Mbtd1 A G 11: 93,943,796 E600G probably benign Het
Mfap3 T G 11: 57,529,503 N103K probably damaging Het
Mtor G A 4: 148,556,344 E2536K possibly damaging Het
Mug2 G A 6: 122,079,726 S1210N probably benign Het
Nat8 G A 6: 85,830,495 L219F probably benign Het
Nisch A G 14: 31,171,701 V1305A probably benign Het
Nup153 A T 13: 46,696,644 probably null Het
Olfr401 G A 11: 74,121,985 R232H probably benign Het
Otud6b A T 4: 14,825,858 probably null Het
Pbld2 A G 10: 63,048,004 T83A probably damaging Het
Pcx A T 19: 4,621,178 M1144L probably benign Het
Pdpk1 C A 17: 24,110,900 R81L probably benign Het
Pik3cd A T 4: 149,651,763 probably null Het
Plch2 A C 4: 154,983,737 D1477E probably damaging Het
Plek2 A G 12: 78,900,110 I51T probably damaging Het
Plekhn1 A G 4: 156,230,685 V505A probably benign Het
Pofut2 T C 10: 77,262,439 S129P possibly damaging Het
Prdx5 C A 19: 6,910,002 probably benign Het
Proca1 G T 11: 78,194,817 probably benign Het
Prrxl1 A G 14: 32,628,821 S205G probably damaging Het
Ptprs A C 17: 56,414,793 Y1752D probably damaging Het
Pum1 G A 4: 130,774,545 V1127M probably damaging Het
Ralbp1 T C 17: 65,858,981 R403G probably damaging Het
Reps1 A T 10: 18,093,887 H246L possibly damaging Het
Rps6kc1 A C 1: 190,799,096 M903R probably damaging Het
Rubcnl A G 14: 75,049,643 T584A probably benign Het
Samd9l A T 6: 3,374,408 V951E probably damaging Het
Sbf2 A G 7: 110,438,848 F463L possibly damaging Het
Sdr16c6 G A 4: 4,076,921 probably benign Het
Slc26a8 A G 17: 28,648,203 I548T probably benign Het
Slc2a13 T A 15: 91,572,680 I140F probably damaging Het
Smtn A T 11: 3,531,200 probably null Het
Sobp G T 10: 43,022,568 C340* probably null Het
Sox6 A T 7: 115,550,023 V413E probably benign Het
Spin1 T C 13: 51,123,290 probably null Het
Sra1 T C 18: 36,667,483 T224A probably benign Het
Sv2c A T 13: 96,048,548 F207Y probably benign Het
Tcp10c T A 17: 13,361,241 probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tkt G A 14: 30,571,035 G490S possibly damaging Het
Tpgs1 G T 10: 79,675,821 A266S probably damaging Het
Tprg T G 16: 25,422,253 S260A probably damaging Het
Trdv2-1 T A 14: 53,946,478 W56R probably damaging Het
Trpc4 T A 3: 54,318,029 V933E probably benign Het
Ulk4 A T 9: 121,103,621 M1051K possibly damaging Het
Unc119b A G 5: 115,134,684 L76P probably damaging Het
Vmn2r15 G A 5: 109,297,528 S10F probably benign Het
Vwce A G 19: 10,664,340 E810G probably benign Het
Wdr7 T A 18: 63,777,380 probably null Het
Wnk2 T A 13: 49,038,132 E1283V probably benign Het
Zfp28 T C 7: 6,393,957 C464R probably damaging Het
Zpld1 C T 16: 55,233,664 C255Y probably damaging Het
Other mutations in Apaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Apaf1 APN 10 91023788 missense probably damaging 0.99
IGL00819:Apaf1 APN 10 90997340 splice site probably null
IGL01481:Apaf1 APN 10 91031588 missense possibly damaging 0.84
IGL01713:Apaf1 APN 10 91061832 splice site probably benign
IGL01715:Apaf1 APN 10 91058354 missense probably benign 0.20
IGL02152:Apaf1 APN 10 91061819 missense probably benign 0.24
IGL02331:Apaf1 APN 10 91059619 missense probably damaging 1.00
IGL03071:Apaf1 APN 10 90997255 missense possibly damaging 0.88
IGL03101:Apaf1 APN 10 91031559 missense possibly damaging 0.89
IGL03244:Apaf1 APN 10 91049349 splice site probably benign
Mayhem UTSW 10 90999719 missense probably damaging 0.99
Wipeout UTSW 10 91056000 missense probably damaging 1.00
R0520:Apaf1 UTSW 10 91079989 missense probably damaging 0.99
R0600:Apaf1 UTSW 10 91060052 missense probably damaging 1.00
R0607:Apaf1 UTSW 10 91009203 missense probably damaging 1.00
R0688:Apaf1 UTSW 10 91061705 missense possibly damaging 0.94
R0734:Apaf1 UTSW 10 91037021 missense probably benign 0.02
R1256:Apaf1 UTSW 10 91058406 missense probably benign
R1459:Apaf1 UTSW 10 91062160 missense probably benign 0.00
R1485:Apaf1 UTSW 10 91060243 missense probably benign 0.02
R1511:Apaf1 UTSW 10 91060185 missense possibly damaging 0.81
R1531:Apaf1 UTSW 10 91054521 missense probably damaging 1.00
R1705:Apaf1 UTSW 10 91067271 splice site probably benign
R1919:Apaf1 UTSW 10 91077614 nonsense probably null
R1925:Apaf1 UTSW 10 90999719 missense probably damaging 0.99
R2001:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2002:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2006:Apaf1 UTSW 10 91061772 missense probably damaging 1.00
R2043:Apaf1 UTSW 10 91037028 missense probably damaging 1.00
R2073:Apaf1 UTSW 10 91031694 nonsense probably null
R2101:Apaf1 UTSW 10 91060080 missense probably benign 0.26
R2130:Apaf1 UTSW 10 91060165 nonsense probably null
R2153:Apaf1 UTSW 10 91048090 missense probably damaging 1.00
R2377:Apaf1 UTSW 10 91079893 missense possibly damaging 0.95
R2421:Apaf1 UTSW 10 91020723 missense probably damaging 1.00
R3835:Apaf1 UTSW 10 91059587 missense probably benign 0.07
R4750:Apaf1 UTSW 10 91060188 missense probably damaging 1.00
R5100:Apaf1 UTSW 10 90997287 missense probably benign
R5135:Apaf1 UTSW 10 91060094 missense probably damaging 1.00
R5497:Apaf1 UTSW 10 90999656 missense probably damaging 1.00
R5511:Apaf1 UTSW 10 91054392 missense probably damaging 1.00
R5659:Apaf1 UTSW 10 91062153 nonsense probably null
R5730:Apaf1 UTSW 10 91020771 missense possibly damaging 0.62
R6176:Apaf1 UTSW 10 91059571 critical splice donor site probably null
R6242:Apaf1 UTSW 10 91062163 missense probably damaging 1.00
R6292:Apaf1 UTSW 10 90991563 missense possibly damaging 0.86
R6376:Apaf1 UTSW 10 91023811 missense probably damaging 1.00
R6534:Apaf1 UTSW 10 91056000 missense probably damaging 1.00
R6975:Apaf1 UTSW 10 91020734 missense probably damaging 0.97
R7218:Apaf1 UTSW 10 91037002 missense probably damaging 1.00
R7369:Apaf1 UTSW 10 91001036 missense probably damaging 0.97
R7409:Apaf1 UTSW 10 91067246 missense probably damaging 1.00
R7413:Apaf1 UTSW 10 90995680 missense probably benign 0.28
R7418:Apaf1 UTSW 10 91023835 missense probably benign 0.09
R7488:Apaf1 UTSW 10 91054380 missense probably benign 0.35
R7765:Apaf1 UTSW 10 91023782 missense probably benign 0.34
R7913:Apaf1 UTSW 10 91060271 missense probably damaging 0.99
R7914:Apaf1 UTSW 10 91060233 missense probably damaging 1.00
R7922:Apaf1 UTSW 10 90999753 missense probably benign
R8131:Apaf1 UTSW 10 91077558 missense possibly damaging 0.93
R8158:Apaf1 UTSW 10 91059658 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGTGCCATCTCTCCAGCC -3'
(R):5'- ACTTACTGCTCATTGTCCTTTTATGG -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- CCTTTTATGGTCTGCTAAATGCTAG -3'
Posted On2019-10-07