Incidental Mutation 'R7423:Sv2c'
ID 575860
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Name synaptic vesicle glycoprotein 2c
Synonyms 4930527L09Rik
MMRRC Submission 045501-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R7423 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 96091102-96269085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 96185056 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 207 (F207Y)
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
AlphaFold Q69ZS6
Predicted Effect probably benign
Transcript: ENSMUST00000161263
AA Change: F207Y

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: F207Y

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182289
AA Change: F207Y

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: F207Y

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (91/95)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A T 17: 57,175,257 (GRCm39) M85K probably benign Het
Actn4 C T 7: 28,593,680 (GRCm39) A905T probably damaging Het
Aff1 T A 5: 103,994,967 (GRCm39) V1055D probably damaging Het
Aox3 A G 1: 58,160,228 (GRCm39) E137G possibly damaging Het
Apaf1 A T 10: 90,895,468 (GRCm39) D443E probably damaging Het
Arl5b C A 2: 15,072,983 (GRCm39) A28E probably damaging Het
Atg16l1 T C 1: 87,714,023 (GRCm39) V478A probably damaging Het
Atp6v1f G C 6: 29,468,105 (GRCm39) E13Q probably null Het
Atpaf1 A T 4: 115,647,827 (GRCm39) K162M probably damaging Het
C3 A T 17: 57,521,767 (GRCm39) L1100Q probably damaging Het
Ccr1 A G 9: 123,764,422 (GRCm39) L36P probably damaging Het
Cct3 T C 3: 88,216,503 (GRCm39) L153S probably benign Het
Chd4 A G 6: 125,105,822 (GRCm39) D1813G possibly damaging Het
Chrm3 T C 13: 9,928,845 (GRCm39) I64V probably benign Het
Cnot2 A T 10: 116,328,303 (GRCm39) V477E probably damaging Het
Csf2rb2 T A 15: 78,176,760 (GRCm39) I211F possibly damaging Het
Dnah8 T C 17: 30,923,743 (GRCm39) L1237P possibly damaging Het
Dnttip2 T C 3: 122,069,175 (GRCm39) V130A probably benign Het
Dock10 G A 1: 80,501,497 (GRCm39) A1852V possibly damaging Het
Dock3 A G 9: 106,844,370 (GRCm39) V910A probably damaging Het
Drgx A G 14: 32,350,778 (GRCm39) S205G probably damaging Het
Fbrs G A 7: 127,088,633 (GRCm39) W738* probably null Het
Fmnl3 T A 15: 99,227,281 (GRCm39) D162V probably damaging Het
Fosl2 A G 5: 32,307,807 (GRCm39) R133G probably damaging Het
Frmpd1 A G 4: 45,256,948 (GRCm39) Q172R probably damaging Het
Fsd1l A T 4: 53,686,406 (GRCm39) D273V probably damaging Het
Fstl4 T A 11: 52,959,382 (GRCm39) M141K possibly damaging Het
Gcfc2 A G 6: 81,923,541 (GRCm39) D535G probably damaging Het
Gm19410 A C 8: 36,271,761 (GRCm39) D1277A probably benign Het
Gnmt T A 17: 47,037,066 (GRCm39) N211Y probably damaging Het
Hic2 A G 16: 17,075,993 (GRCm39) D274G probably damaging Het
Hnrnpu A G 1: 178,156,849 (GRCm39) probably benign Het
Icam5 T C 9: 20,948,201 (GRCm39) S670P probably benign Het
Ighv5-4 A T 12: 113,561,120 (GRCm39) L100Q probably damaging Het
Il17rb A T 14: 29,719,072 (GRCm39) S337T probably damaging Het
Inf2 G T 12: 112,576,172 (GRCm39) R883L unknown Het
Inhbc C T 10: 127,193,275 (GRCm39) C247Y probably damaging Het
Ints4 A G 7: 97,156,926 (GRCm39) K333E probably damaging Het
Iyd A T 10: 3,497,088 (GRCm39) I148F probably damaging Het
Klk1b26 A T 7: 43,664,193 (GRCm39) D16V probably damaging Het
Krt15 A T 11: 100,026,386 (GRCm39) V100E possibly damaging Het
Lama2 A T 10: 27,088,222 (GRCm39) S852T probably benign Het
Mbtd1 A G 11: 93,834,622 (GRCm39) E600G probably benign Het
Mfap3 T G 11: 57,420,329 (GRCm39) N103K probably damaging Het
Mtor G A 4: 148,640,801 (GRCm39) E2536K possibly damaging Het
Mug2 G A 6: 122,056,685 (GRCm39) S1210N probably benign Het
Nat8 G A 6: 85,807,477 (GRCm39) L219F probably benign Het
Nisch A G 14: 30,893,658 (GRCm39) V1305A probably benign Het
Nup153 A T 13: 46,850,120 (GRCm39) probably null Het
Or3a1b G A 11: 74,012,811 (GRCm39) R232H probably benign Het
Otud6b A T 4: 14,825,858 (GRCm39) probably null Het
Pbld2 A G 10: 62,883,783 (GRCm39) T83A probably damaging Het
Pcx A T 19: 4,671,206 (GRCm39) M1144L probably benign Het
Pdpk1 C A 17: 24,329,874 (GRCm39) R81L probably benign Het
Pik3cd A T 4: 149,736,220 (GRCm39) probably null Het
Plch2 A C 4: 155,068,194 (GRCm39) D1477E probably damaging Het
Plek2 A G 12: 78,946,884 (GRCm39) I51T probably damaging Het
Plekhn1 A G 4: 156,315,142 (GRCm39) V505A probably benign Het
Pofut2 T C 10: 77,098,273 (GRCm39) S129P possibly damaging Het
Prdx5 C A 19: 6,887,370 (GRCm39) probably benign Het
Proca1 G T 11: 78,085,643 (GRCm39) probably benign Het
Ptprs A C 17: 56,721,793 (GRCm39) Y1752D probably damaging Het
Pum1 G A 4: 130,501,856 (GRCm39) V1127M probably damaging Het
Ralbp1 T C 17: 66,165,976 (GRCm39) R403G probably damaging Het
Reps1 A T 10: 17,969,635 (GRCm39) H246L possibly damaging Het
Rps6kc1 A C 1: 190,531,293 (GRCm39) M903R probably damaging Het
Rubcnl A G 14: 75,287,083 (GRCm39) T584A probably benign Het
Samd9l A T 6: 3,374,408 (GRCm39) V951E probably damaging Het
Sbf2 A G 7: 110,038,055 (GRCm39) F463L possibly damaging Het
Sdr16c6 G A 4: 4,076,921 (GRCm39) probably benign Het
Shoc1 A T 4: 59,076,264 (GRCm39) S560T probably benign Het
Slc26a8 A G 17: 28,867,177 (GRCm39) I548T probably benign Het
Slc2a13 T A 15: 91,456,883 (GRCm39) I140F probably damaging Het
Smtn A T 11: 3,481,200 (GRCm39) probably null Het
Sobp G T 10: 42,898,564 (GRCm39) C340* probably null Het
Sox6 A T 7: 115,149,258 (GRCm39) V413E probably benign Het
Spin1 T C 13: 51,277,326 (GRCm39) probably null Het
Sra1 T C 18: 36,800,536 (GRCm39) T224A probably benign Het
Tcp10c T A 17: 13,581,503 (GRCm39) probably null Het
Tkt G A 14: 30,292,992 (GRCm39) G490S possibly damaging Het
Tpgs1 G T 10: 79,511,655 (GRCm39) A266S probably damaging Het
Tprg1 T G 16: 25,241,003 (GRCm39) S260A probably damaging Het
Trdv2-1 T A 14: 54,183,935 (GRCm39) W56R probably damaging Het
Trgv6 G T 13: 19,374,814 (GRCm39) G40W possibly damaging Het
Trpc4 T A 3: 54,225,450 (GRCm39) V933E probably benign Het
Ulk4 A T 9: 120,932,687 (GRCm39) M1051K possibly damaging Het
Unc119b A G 5: 115,272,743 (GRCm39) L76P probably damaging Het
Vmn2r15 G A 5: 109,445,394 (GRCm39) S10F probably benign Het
Vwce A G 19: 10,641,704 (GRCm39) E810G probably benign Het
Wdr7 T A 18: 63,910,451 (GRCm39) probably null Het
Wnk2 T A 13: 49,191,608 (GRCm39) E1283V probably benign Het
Zfp28 T C 7: 6,396,956 (GRCm39) C464R probably damaging Het
Zpld1 C T 16: 55,054,027 (GRCm39) C255Y probably damaging Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96,184,937 (GRCm39) missense probably damaging 1.00
IGL01313:Sv2c APN 13 96,224,797 (GRCm39) missense probably damaging 1.00
IGL02710:Sv2c APN 13 96,125,649 (GRCm39) missense probably damaging 0.99
IGL02990:Sv2c APN 13 96,224,886 (GRCm39) missense probably damaging 1.00
IGL03145:Sv2c APN 13 96,125,606 (GRCm39) missense probably damaging 1.00
D4043:Sv2c UTSW 13 96,224,989 (GRCm39) missense probably benign 0.27
R0390:Sv2c UTSW 13 96,225,216 (GRCm39) missense probably benign
R0849:Sv2c UTSW 13 96,126,319 (GRCm39) missense probably damaging 1.00
R0907:Sv2c UTSW 13 96,224,763 (GRCm39) missense probably damaging 1.00
R1177:Sv2c UTSW 13 96,126,271 (GRCm39) missense possibly damaging 0.79
R1840:Sv2c UTSW 13 96,118,352 (GRCm39) missense probably benign 0.08
R1865:Sv2c UTSW 13 96,113,283 (GRCm39) missense probably benign 0.29
R1959:Sv2c UTSW 13 96,113,153 (GRCm39) missense probably damaging 1.00
R2440:Sv2c UTSW 13 96,185,084 (GRCm39) missense probably damaging 1.00
R4007:Sv2c UTSW 13 96,123,341 (GRCm39) splice site probably benign
R4197:Sv2c UTSW 13 96,114,636 (GRCm39) missense probably damaging 1.00
R4697:Sv2c UTSW 13 96,122,526 (GRCm39) missense possibly damaging 0.64
R4719:Sv2c UTSW 13 96,123,319 (GRCm39) missense probably benign 0.21
R4822:Sv2c UTSW 13 96,122,457 (GRCm39) missense probably damaging 1.00
R5237:Sv2c UTSW 13 96,118,391 (GRCm39) missense possibly damaging 0.76
R5452:Sv2c UTSW 13 96,114,591 (GRCm39) missense probably damaging 1.00
R5531:Sv2c UTSW 13 96,097,886 (GRCm39) missense probably damaging 0.98
R5756:Sv2c UTSW 13 96,122,475 (GRCm39) missense probably benign
R5982:Sv2c UTSW 13 96,112,571 (GRCm39) nonsense probably null
R6220:Sv2c UTSW 13 96,113,134 (GRCm39) missense probably damaging 1.00
R6511:Sv2c UTSW 13 96,185,033 (GRCm39) missense probably benign 0.00
R6520:Sv2c UTSW 13 96,123,229 (GRCm39) missense probably benign
R7001:Sv2c UTSW 13 96,118,461 (GRCm39) missense probably benign 0.11
R7073:Sv2c UTSW 13 96,224,758 (GRCm39) missense probably damaging 1.00
R7116:Sv2c UTSW 13 96,113,152 (GRCm39) missense probably damaging 1.00
R7261:Sv2c UTSW 13 96,224,809 (GRCm39) missense probably damaging 1.00
R7374:Sv2c UTSW 13 96,125,644 (GRCm39) missense probably damaging 1.00
R7626:Sv2c UTSW 13 96,122,451 (GRCm39) missense probably benign 0.13
R7727:Sv2c UTSW 13 96,113,203 (GRCm39) missense possibly damaging 0.89
R7767:Sv2c UTSW 13 96,126,223 (GRCm39) missense probably damaging 1.00
R7818:Sv2c UTSW 13 96,123,328 (GRCm39) nonsense probably null
R7831:Sv2c UTSW 13 96,113,200 (GRCm39) missense probably damaging 1.00
R7991:Sv2c UTSW 13 96,224,797 (GRCm39) missense probably damaging 1.00
R8137:Sv2c UTSW 13 96,225,171 (GRCm39) missense probably damaging 0.96
R8254:Sv2c UTSW 13 96,225,073 (GRCm39) missense probably damaging 1.00
R9192:Sv2c UTSW 13 96,224,755 (GRCm39) missense probably benign 0.00
R9203:Sv2c UTSW 13 96,224,745 (GRCm39) nonsense probably null
R9278:Sv2c UTSW 13 96,112,589 (GRCm39) missense probably damaging 0.98
R9547:Sv2c UTSW 13 96,185,008 (GRCm39) missense probably benign 0.03
R9585:Sv2c UTSW 13 96,122,466 (GRCm39) missense probably benign
Z1176:Sv2c UTSW 13 96,112,605 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTAGGCTGACACAGAAATAGAAG -3'
(R):5'- CCCTGAGGATGTGCGTTTAG -3'

Sequencing Primer
(F):5'- AGAGTAAAACTGTGTGCAATCAC -3'
(R):5'- GCGGTGTTTCCCTGCGTAAAG -3'
Posted On 2019-10-07