Mutagenetix > Incidental Mutation

Incidental Mutation 'R7423:Dnah8'

575875

Institutional Source

Beutler Lab

Gene Symbol

Dnah8

Ensembl Gene

ENSMUSG00000033826

Gene Name

dynein, axonemal, heavy chain 8

Synonyms

Dnahc8, P1-Loop, Hst6.7b

MMRRC Submission

045501-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.323) question?

Stock #

R7423 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30624354-30875264 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30704769 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1237 (L1237P)

Ref Sequence

ENSEMBL: ENSMUSP00000127878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170651]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170651
AA Change: L1237P

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: L1237P

Domain	Start	End	E-Value	Type
low complexity region	2	54	N/A	INTRINSIC
Pfam:DHC_N1	379	936	8.4e-159	PFAM
low complexity region	1069	1080	N/A	INTRINSIC
low complexity region	1224	1237	N/A	INTRINSIC
Pfam:DHC_N2	1509	1917	1.6e-134	PFAM
AAA	2082	2226	1.38e-1	SMART
AAA	2363	2516	2.04e-1	SMART
AAA	2689	2837	8.15e-2	SMART
Pfam:AAA_8	3022	3294	4e-72	PFAM
Pfam:MT	3306	3656	3.6e-48	PFAM
Pfam:AAA_9	3676	3901	6.7e-85	PFAM
Pfam:Dynein_heavy	4039	4728	8.4e-250	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

96% (91/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsbg2	A	T	17: 56,868,257	M85K	probably benign	Het
Actn4	C	T	7: 28,894,255	A905T	probably damaging	Het
Aff1	T	A	5: 103,847,101	V1055D	probably damaging	Het
AI481877	A	T	4: 59,076,264	S560T	probably benign	Het
Aox3	A	G	1: 58,121,069	E137G	possibly damaging	Het
Apaf1	A	T	10: 91,059,606	D443E	probably damaging	Het
Arl5b	C	A	2: 15,068,172	A28E	probably damaging	Het
Atg16l1	T	C	1: 87,786,301	V478A	probably damaging	Het
Atp6v1f	G	C	6: 29,468,106	E13Q	probably null	Het
Atpaf1	A	T	4: 115,790,630	K162M	probably damaging	Het
C3	A	T	17: 57,214,767	L1100Q	probably damaging	Het
Ccr1	A	G	9: 123,964,385	L36P	probably damaging	Het
Cct3	T	C	3: 88,309,196	L153S	probably benign	Het
Chd4	A	G	6: 125,128,859	D1813G	possibly damaging	Het
Chrm3	T	C	13: 9,878,809	I64V	probably benign	Het
Cnot2	A	T	10: 116,492,398	V477E	probably damaging	Het
Csf2rb2	T	A	15: 78,292,560	I211F	possibly damaging	Het
Dnttip2	T	C	3: 122,275,526	V130A	probably benign	Het
Dock10	G	A	1: 80,523,780	A1852V	possibly damaging	Het
Dock3	A	G	9: 106,967,171	V910A	probably damaging	Het
Fbrs	G	A	7: 127,489,461	W738*	probably null	Het
Fmnl3	T	A	15: 99,329,400	D162V	probably damaging	Het
Fosl2	A	G	5: 32,150,463	R133G	probably damaging	Het
Frmpd1	A	G	4: 45,256,948	Q172R	probably damaging	Het
Fsd1l	A	T	4: 53,686,406	D273V	probably damaging	Het
Fstl4	T	A	11: 53,068,555	M141K	possibly damaging	Het
Gcfc2	A	G	6: 81,946,560	D535G	probably damaging	Het
Gm19410	A	C	8: 35,804,607	D1277A	probably benign	Het
Gnmt	T	A	17: 46,726,140	N211Y	probably damaging	Het
Hic2	A	G	16: 17,258,129	D274G	probably damaging	Het
Hnrnpu	A	G	1: 178,329,284		probably benign	Het
Icam5	T	C	9: 21,036,905	S670P	probably benign	Het
Ighv5-4	A	T	12: 113,597,500	L100Q	probably damaging	Het
Il17rb	A	T	14: 29,997,115	S337T	probably damaging	Het
Inf2	G	T	12: 112,609,738	R883L	unknown	Het
Inhbc	C	T	10: 127,357,406	C247Y	probably damaging	Het
Ints4	A	G	7: 97,507,719	K333E	probably damaging	Het
Iyd	A	T	10: 3,547,088	I148F	probably damaging	Het
Klk1b26	A	T	7: 44,014,769	D16V	probably damaging	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Lama2	A	T	10: 27,212,226	S852T	probably benign	Het
Mbtd1	A	G	11: 93,943,796	E600G	probably benign	Het
Mfap3	T	G	11: 57,529,503	N103K	probably damaging	Het
Mtor	G	A	4: 148,556,344	E2536K	possibly damaging	Het
Mug2	G	A	6: 122,079,726	S1210N	probably benign	Het
Nat8	G	A	6: 85,830,495	L219F	probably benign	Het
Nisch	A	G	14: 31,171,701	V1305A	probably benign	Het
Nup153	A	T	13: 46,696,644		probably null	Het
Olfr401	G	A	11: 74,121,985	R232H	probably benign	Het
Otud6b	A	T	4: 14,825,858		probably null	Het
Pbld2	A	G	10: 63,048,004	T83A	probably damaging	Het
Pcx	A	T	19: 4,621,178	M1144L	probably benign	Het
Pdpk1	C	A	17: 24,110,900	R81L	probably benign	Het
Pik3cd	A	T	4: 149,651,763		probably null	Het
Plch2	A	C	4: 154,983,737	D1477E	probably damaging	Het
Plek2	A	G	12: 78,900,110	I51T	probably damaging	Het
Plekhn1	A	G	4: 156,230,685	V505A	probably benign	Het
Pofut2	T	C	10: 77,262,439	S129P	possibly damaging	Het
Prdx5	C	A	19: 6,910,002		probably benign	Het
Proca1	G	T	11: 78,194,817		probably benign	Het
Prrxl1	A	G	14: 32,628,821	S205G	probably damaging	Het
Ptprs	A	C	17: 56,414,793	Y1752D	probably damaging	Het
Pum1	G	A	4: 130,774,545	V1127M	probably damaging	Het
Ralbp1	T	C	17: 65,858,981	R403G	probably damaging	Het
Reps1	A	T	10: 18,093,887	H246L	possibly damaging	Het
Rps6kc1	A	C	1: 190,799,096	M903R	probably damaging	Het
Rubcnl	A	G	14: 75,049,643	T584A	probably benign	Het
Samd9l	A	T	6: 3,374,408	V951E	probably damaging	Het
Sbf2	A	G	7: 110,438,848	F463L	possibly damaging	Het
Sdr16c6	G	A	4: 4,076,921		probably benign	Het
Slc26a8	A	G	17: 28,648,203	I548T	probably benign	Het
Slc2a13	T	A	15: 91,572,680	I140F	probably damaging	Het
Smtn	A	T	11: 3,531,200		probably null	Het
Sobp	G	T	10: 43,022,568	C340*	probably null	Het
Sox6	A	T	7: 115,550,023	V413E	probably benign	Het
Spin1	T	C	13: 51,123,290		probably null	Het
Sra1	T	C	18: 36,667,483	T224A	probably benign	Het
Sv2c	A	T	13: 96,048,548	F207Y	probably benign	Het
Tcp10c	T	A	17: 13,361,241		probably null	Het
Tcrg-V6	G	T	13: 19,190,644	G40W	possibly damaging	Het
Tkt	G	A	14: 30,571,035	G490S	possibly damaging	Het
Tpgs1	G	T	10: 79,675,821	A266S	probably damaging	Het
Tprg	T	G	16: 25,422,253	S260A	probably damaging	Het
Trdv2-1	T	A	14: 53,946,478	W56R	probably damaging	Het
Trpc4	T	A	3: 54,318,029	V933E	probably benign	Het
Ulk4	A	T	9: 121,103,621	M1051K	possibly damaging	Het
Unc119b	A	G	5: 115,134,684	L76P	probably damaging	Het
Vmn2r15	G	A	5: 109,297,528	S10F	probably benign	Het
Vwce	A	G	19: 10,664,340	E810G	probably benign	Het
Wdr7	T	A	18: 63,777,380		probably null	Het
Wnk2	T	A	13: 49,038,132	E1283V	probably benign	Het
Zfp28	T	C	7: 6,393,957	C464R	probably damaging	Het
Zpld1	C	T	16: 55,233,664	C255Y	probably damaging	Het

Other mutations in Dnah8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Dnah8	APN	17	30677176	missense	probably benign	0.06
IGL00508:Dnah8	APN	17	30855930	missense	probably damaging	1.00
IGL00547:Dnah8	APN	17	30815703	nonsense	probably null
IGL00551:Dnah8	APN	17	30663478	nonsense	probably null
IGL00732:Dnah8	APN	17	30656641	missense	probably damaging	1.00
IGL00775:Dnah8	APN	17	30767906	nonsense	probably null
IGL00840:Dnah8	APN	17	30790941	missense	probably damaging	1.00
IGL00845:Dnah8	APN	17	30819276	critical splice donor site	probably null
IGL00953:Dnah8	APN	17	30706457	nonsense	probably null
IGL00976:Dnah8	APN	17	30851710	missense	probably damaging	0.98
IGL01395:Dnah8	APN	17	30636005	missense	probably benign	0.06
IGL01467:Dnah8	APN	17	30779916	missense	probably damaging	1.00
IGL01469:Dnah8	APN	17	30683714	splice site	probably benign
IGL01515:Dnah8	APN	17	30648485	missense	probably benign
IGL01723:Dnah8	APN	17	30708471	missense	probably damaging	1.00
IGL01837:Dnah8	APN	17	30751591	critical splice donor site	probably null
IGL01921:Dnah8	APN	17	30736141	missense	probably benign
IGL01958:Dnah8	APN	17	30855895	splice site	probably benign
IGL01968:Dnah8	APN	17	30656598	nonsense	probably null
IGL02093:Dnah8	APN	17	30717880	missense	probably damaging	0.99
IGL02151:Dnah8	APN	17	30648417	missense	possibly damaging	0.50
IGL02182:Dnah8	APN	17	30794763	missense	possibly damaging	0.45
IGL02233:Dnah8	APN	17	30706513	critical splice donor site	probably null
IGL02236:Dnah8	APN	17	30649773	nonsense	probably null
IGL02259:Dnah8	APN	17	30759614	missense	probably benign
IGL02263:Dnah8	APN	17	30729165	missense	probably benign	0.00
IGL02303:Dnah8	APN	17	30713047	missense	probably benign	0.03
IGL02341:Dnah8	APN	17	30747257	missense	probably damaging	1.00
IGL02351:Dnah8	APN	17	30767811	missense	probably damaging	1.00
IGL02358:Dnah8	APN	17	30767811	missense	probably damaging	1.00
IGL02377:Dnah8	APN	17	30794796	missense	probably damaging	0.98
IGL02390:Dnah8	APN	17	30830845	missense	probably benign	0.01
IGL02392:Dnah8	APN	17	30818051	splice site	probably benign
IGL02414:Dnah8	APN	17	30700413	missense	probably benign
IGL02455:Dnah8	APN	17	30672334	missense	probably damaging	0.99
IGL02817:Dnah8	APN	17	30668295	missense	probably benign
IGL02831:Dnah8	APN	17	30712276	missense	probably benign	0.23
IGL02863:Dnah8	APN	17	30769697	missense	probably damaging	1.00
IGL02894:Dnah8	APN	17	30721110	nonsense	probably null
IGL02954:Dnah8	APN	17	30704835	missense	probably benign	0.30
IGL02964:Dnah8	APN	17	30746761	missense	probably damaging	1.00
IGL03080:Dnah8	APN	17	30719006	missense	probably benign	0.01
IGL03081:Dnah8	APN	17	30686373	splice site	probably benign
IGL03086:Dnah8	APN	17	30742780	missense	probably damaging	1.00
IGL03087:Dnah8	APN	17	30784144	missense	probably benign
IGL03176:Dnah8	APN	17	30694037	missense	probably benign
IGL03191:Dnah8	APN	17	30726830	missense	probably damaging	0.99
IGL03210:Dnah8	APN	17	30815665	missense	probably damaging	0.96
IGL03252:Dnah8	APN	17	30673920	splice site	probably null
IGL03255:Dnah8	APN	17	30741381	missense	probably damaging	1.00
IGL03288:Dnah8	APN	17	30672349	missense	probably benign
IGL03348:Dnah8	APN	17	30746986	missense	probably damaging	0.99
Alternator	UTSW	17	30765635	missense	probably benign
armature	UTSW	17	30708390	missense	probably benign	0.02
Brush	UTSW	17	30746990	missense	probably damaging	1.00
Dynos	UTSW	17	30715509	missense	possibly damaging	0.84
joule	UTSW	17	30713098	critical splice donor site	probably null
solenoid	UTSW	17	30741178	missense	probably damaging	1.00
FR4340:Dnah8	UTSW	17	30635463	small deletion	probably benign
FR4737:Dnah8	UTSW	17	30635465	small deletion	probably benign
FR4737:Dnah8	UTSW	17	30635477	small deletion	probably benign
I2288:Dnah8	UTSW	17	30663454	missense	probably benign
P0029:Dnah8	UTSW	17	30765720	missense	probably damaging	1.00
PIT4812001:Dnah8	UTSW	17	30708445	missense	probably benign	0.04
R0016:Dnah8	UTSW	17	30663316	missense	probably benign
R0035:Dnah8	UTSW	17	30683621	splice site	probably benign
R0035:Dnah8	UTSW	17	30683621	splice site	probably benign
R0062:Dnah8	UTSW	17	30765711	missense	probably damaging	1.00
R0062:Dnah8	UTSW	17	30765711	missense	probably damaging	1.00
R0087:Dnah8	UTSW	17	30755119	missense	probably damaging	1.00
R0090:Dnah8	UTSW	17	30784090	missense	probably benign	0.20
R0119:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0164:Dnah8	UTSW	17	30748665	missense	probably benign
R0164:Dnah8	UTSW	17	30748665	missense	probably benign
R0184:Dnah8	UTSW	17	30683683	missense	probably benign	0.04
R0240:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0240:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0241:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0241:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0265:Dnah8	UTSW	17	30690271	missense	probably benign
R0268:Dnah8	UTSW	17	30769707	missense	probably damaging	1.00
R0282:Dnah8	UTSW	17	30736156	missense	probably damaging	1.00
R0299:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0334:Dnah8	UTSW	17	30871351	missense	probably damaging	0.99
R0393:Dnah8	UTSW	17	30708390	missense	probably benign	0.02
R0423:Dnah8	UTSW	17	30701981	missense	probably benign
R0470:Dnah8	UTSW	17	30708540	splice site	probably benign
R0477:Dnah8	UTSW	17	30755080	missense	probably damaging	1.00
R0490:Dnah8	UTSW	17	30700419	missense	probably benign
R0499:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0582:Dnah8	UTSW	17	30718961	missense	probably benign	0.01
R0601:Dnah8	UTSW	17	30708358	missense	probably benign	0.06
R0646:Dnah8	UTSW	17	30684173	missense	probably damaging	0.97
R0665:Dnah8	UTSW	17	30736155	missense	probably damaging	0.99
R0800:Dnah8	UTSW	17	30704662	missense	probably benign
R0843:Dnah8	UTSW	17	30813095	missense	probably damaging	1.00
R0940:Dnah8	UTSW	17	30803243	missense	probably damaging	1.00
R0964:Dnah8	UTSW	17	30673920	splice site	probably null
R1102:Dnah8	UTSW	17	30854764	splice site	probably null
R1137:Dnah8	UTSW	17	30855936	missense	probably damaging	1.00
R1342:Dnah8	UTSW	17	30721000	missense	probably damaging	0.99
R1375:Dnah8	UTSW	17	30737295	missense	probably damaging	1.00
R1377:Dnah8	UTSW	17	30840622	nonsense	probably null
R1464:Dnah8	UTSW	17	30695173	missense	possibly damaging	0.81
R1464:Dnah8	UTSW	17	30695173	missense	possibly damaging	0.81
R1470:Dnah8	UTSW	17	30747277	nonsense	probably null
R1470:Dnah8	UTSW	17	30747277	nonsense	probably null
R1497:Dnah8	UTSW	17	30752075	missense	probably damaging	1.00
R1513:Dnah8	UTSW	17	30673888	missense	probably benign
R1541:Dnah8	UTSW	17	30747247	missense	probably damaging	1.00
R1563:Dnah8	UTSW	17	30635664	missense	probably benign	0.07
R1634:Dnah8	UTSW	17	30713098	critical splice donor site	probably null
R1670:Dnah8	UTSW	17	30725124	missense	probably damaging	1.00
R1710:Dnah8	UTSW	17	30854940	missense	probably damaging	1.00
R1743:Dnah8	UTSW	17	30769651	missense	probably benign	0.28
R1761:Dnah8	UTSW	17	30779916	missense	probably damaging	1.00
R1785:Dnah8	UTSW	17	30722937	missense	probably damaging	0.98
R1804:Dnah8	UTSW	17	30708407	missense	probably benign	0.00
R1808:Dnah8	UTSW	17	30684186	missense	probably damaging	1.00
R1824:Dnah8	UTSW	17	30731180	missense	possibly damaging	0.67
R1836:Dnah8	UTSW	17	30874927	missense	possibly damaging	0.94
R1935:Dnah8	UTSW	17	30635505	missense	unknown
R1935:Dnah8	UTSW	17	30726896	splice site	probably benign
R1940:Dnah8	UTSW	17	30731207	missense	probably damaging	1.00
R1946:Dnah8	UTSW	17	30712385	missense	probably benign	0.00
R2025:Dnah8	UTSW	17	30731159	missense	probably damaging	0.99
R2038:Dnah8	UTSW	17	30758281	missense	probably damaging	1.00
R2042:Dnah8	UTSW	17	30635658	missense	probably benign	0.01
R2148:Dnah8	UTSW	17	30737258	missense	probably damaging	1.00
R2177:Dnah8	UTSW	17	30653393	missense	probably benign
R2180:Dnah8	UTSW	17	30840647	missense	probably benign	0.00
R2262:Dnah8	UTSW	17	30673835	missense	probably damaging	1.00
R2263:Dnah8	UTSW	17	30673835	missense	probably damaging	1.00
R2328:Dnah8	UTSW	17	30794744	missense	probably damaging	1.00
R2357:Dnah8	UTSW	17	30771872	missense	probably benign
R2357:Dnah8	UTSW	17	30874935	missense	probably benign	0.00
R2360:Dnah8	UTSW	17	30677204	missense	probably benign	0.22
R2496:Dnah8	UTSW	17	30851731	missense	probably damaging	1.00
R2497:Dnah8	UTSW	17	30741365	nonsense	probably null
R2509:Dnah8	UTSW	17	30775045	missense	probably benign	0.02
R3114:Dnah8	UTSW	17	30833568	missense	probably benign	0.04
R3708:Dnah8	UTSW	17	30739657	missense	probably damaging	0.98
R3720:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3722:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3727:Dnah8	UTSW	17	30739648	nonsense	probably null
R3747:Dnah8	UTSW	17	30784174	nonsense	probably null
R3748:Dnah8	UTSW	17	30784174	nonsense	probably null
R3749:Dnah8	UTSW	17	30784174	nonsense	probably null
R3787:Dnah8	UTSW	17	30755041	missense	probably damaging	1.00
R3790:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3804:Dnah8	UTSW	17	30670647	missense	probably benign	0.00
R3857:Dnah8	UTSW	17	30663422	missense	probably damaging	0.96
R3898:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3899:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3938:Dnah8	UTSW	17	30854937	missense	probably damaging	1.00
R3943:Dnah8	UTSW	17	30694065	splice site	probably benign
R4091:Dnah8	UTSW	17	30769839	missense	probably damaging	1.00
R4291:Dnah8	UTSW	17	30748559	missense	probably benign
R4326:Dnah8	UTSW	17	30752092	missense	probably benign	0.04
R4346:Dnah8	UTSW	17	30725098	missense	possibly damaging	0.92
R4429:Dnah8	UTSW	17	30752146	missense	probably damaging	1.00
R4457:Dnah8	UTSW	17	30813151	missense	probably benign
R4475:Dnah8	UTSW	17	30656985	missense	probably benign	0.12
R4565:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4566:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4568:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4573:Dnah8	UTSW	17	30700406	missense	probably benign	0.00
R4580:Dnah8	UTSW	17	30662052	missense	probably benign	0.00
R4585:Dnah8	UTSW	17	30751567	missense	probably benign	0.01
R4611:Dnah8	UTSW	17	30684237	missense	probably damaging	1.00
R4720:Dnah8	UTSW	17	30683634	missense	probably benign	0.08
R4721:Dnah8	UTSW	17	30725166	missense	probably damaging	1.00
R4727:Dnah8	UTSW	17	30851747	missense	probably damaging	1.00
R4731:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4732:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4733:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4798:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4814:Dnah8	UTSW	17	30767924	missense	probably damaging	1.00
R4892:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4894:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4900:Dnah8	UTSW	17	30746975	missense	probably damaging	1.00
R4901:Dnah8	UTSW	17	30840714	critical splice donor site	probably null
R4913:Dnah8	UTSW	17	30819139	missense	probably damaging	0.99
R4931:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4932:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4933:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4942:Dnah8	UTSW	17	30729142	missense	probably benign
R4969:Dnah8	UTSW	17	30723014	missense	probably damaging	1.00
R4975:Dnah8	UTSW	17	30656985	missense	probably benign	0.12
R4977:Dnah8	UTSW	17	30663301	missense	probably benign	0.00
R5001:Dnah8	UTSW	17	30787185	missense	probably damaging	1.00
R5011:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5013:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5014:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5024:Dnah8	UTSW	17	30736096	missense	probably damaging	1.00
R5075:Dnah8	UTSW	17	30739757	critical splice donor site	probably null
R5075:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5075:Dnah8	UTSW	17	30800531	missense	probably damaging	1.00
R5112:Dnah8	UTSW	17	30731038	missense	probably benign	0.02
R5121:Dnah8	UTSW	17	30810353	missense	probably benign	0.14
R5138:Dnah8	UTSW	17	30765597	missense	probably damaging	0.99
R5151:Dnah8	UTSW	17	30712295	missense	probably benign	0.06
R5191:Dnah8	UTSW	17	30746765	missense	probably damaging	1.00
R5238:Dnah8	UTSW	17	30790917	missense	probably damaging	1.00
R5260:Dnah8	UTSW	17	30700419	missense	probably benign
R5358:Dnah8	UTSW	17	30746954	missense	probably damaging	1.00
R5403:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5404:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5482:Dnah8	UTSW	17	30800547	missense	probably damaging	0.96
R5489:Dnah8	UTSW	17	30790956	missense	probably damaging	1.00
R5513:Dnah8	UTSW	17	30752916	missense	probably damaging	0.99
R5635:Dnah8	UTSW	17	30706386	missense	probably benign	0.00
R5640:Dnah8	UTSW	17	30803108	missense	probably damaging	1.00
R5649:Dnah8	UTSW	17	30800587	missense	probably benign	0.13
R5662:Dnah8	UTSW	17	30737333	missense	probably damaging	1.00
R5673:Dnah8	UTSW	17	30803261	missense	probably damaging	1.00
R5677:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5699:Dnah8	UTSW	17	30810324	missense	probably benign	0.22
R5737:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5738:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5739:Dnah8	UTSW	17	30719007	missense	probably benign	0.00
R5766:Dnah8	UTSW	17	30690261	missense	probably benign	0.01
R5790:Dnah8	UTSW	17	30875004	missense	probably damaging	0.98
R5848:Dnah8	UTSW	17	30728191	missense	possibly damaging	0.69
R5854:Dnah8	UTSW	17	30794763	missense	possibly damaging	0.45
R5885:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5886:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5887:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5899:Dnah8	UTSW	17	30656685	missense	probably benign	0.32
R5979:Dnah8	UTSW	17	30815664	nonsense	probably null
R5986:Dnah8	UTSW	17	30851630	missense	possibly damaging	0.83
R5999:Dnah8	UTSW	17	30663305	missense	probably benign	0.32
R6042:Dnah8	UTSW	17	30747265	missense	probably damaging	1.00
R6175:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6181:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6237:Dnah8	UTSW	17	30747854	nonsense	probably null
R6239:Dnah8	UTSW	17	30810359	missense	probably damaging	0.99
R6337:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6365:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6416:Dnah8	UTSW	17	30765635	missense	probably benign
R6443:Dnah8	UTSW	17	30771885	missense	probably benign	0.10
R6478:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6479:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6480:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6481:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6533:Dnah8	UTSW	17	30746990	missense	probably damaging	1.00
R6606:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6608:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6610:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6675:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6723:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6724:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6754:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6755:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6759:Dnah8	UTSW	17	30663292	splice site	probably null
R6765:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6766:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6778:Dnah8	UTSW	17	30635666	missense	probably benign	0.00
R6781:Dnah8	UTSW	17	30765724	frame shift	probably null
R6788:Dnah8	UTSW	17	30648465	missense	probably benign	0.14
R6814:Dnah8	UTSW	17	30762679	missense	probably damaging	1.00
R6825:Dnah8	UTSW	17	30741173	missense	probably damaging	1.00
R6838:Dnah8	UTSW	17	30710551	missense	probably damaging	1.00
R6872:Dnah8	UTSW	17	30762679	missense	probably damaging	1.00
R6877:Dnah8	UTSW	17	30746959	missense	probably damaging	1.00
R6944:Dnah8	UTSW	17	30794659	missense	probably benign	0.09
R6982:Dnah8	UTSW	17	30767925	missense	probably benign	0.03
R6984:Dnah8	UTSW	17	30739738	missense	probably damaging	1.00
R6987:Dnah8	UTSW	17	30662091	missense	possibly damaging	0.95
R6988:Dnah8	UTSW	17	30643275	missense	probably damaging	1.00
R7099:Dnah8	UTSW	17	30704724	missense	possibly damaging	0.93
R7106:Dnah8	UTSW	17	30741178	missense	probably damaging	1.00
R7112:Dnah8	UTSW	17	30871392	missense	possibly damaging	0.79
R7146:Dnah8	UTSW	17	30644617	missense	probably benign	0.01
R7146:Dnah8	UTSW	17	30769644	missense	possibly damaging	0.90
R7309:Dnah8	UTSW	17	30875014	missense	probably damaging	1.00
R7324:Dnah8	UTSW	17	30784125	missense	probably benign	0.01
R7373:Dnah8	UTSW	17	30767965	critical splice donor site	probably null
R7430:Dnah8	UTSW	17	30706389	missense	probably damaging	0.98
R7450:Dnah8	UTSW	17	30787191	missense	probably damaging	0.99
R7580:Dnah8	UTSW	17	30775103	missense	probably damaging	0.98
R7604:Dnah8	UTSW	17	30813095	missense	probably damaging	1.00
R7635:Dnah8	UTSW	17	30785107	missense	probably damaging	1.00
R7646:Dnah8	UTSW	17	30649677	missense	probably benign	0.00
R7685:Dnah8	UTSW	17	30657973	missense	probably damaging	1.00
R7793:Dnah8	UTSW	17	30855944	missense	probably benign	0.20
R7827:Dnah8	UTSW	17	30760867	frame shift	probably null
R7866:Dnah8	UTSW	17	30874927	missense	possibly damaging	0.94
R7877:Dnah8	UTSW	17	30663374	missense	probably benign
R7891:Dnah8	UTSW	17	30712289	missense	probably benign	0.09
R7977:Dnah8	UTSW	17	30744524	missense	probably damaging	1.00
R7987:Dnah8	UTSW	17	30744524	missense	probably damaging	1.00
R8025:Dnah8	UTSW	17	30741337	nonsense	probably null
R8076:Dnah8	UTSW	17	30784153	missense	possibly damaging	0.94
R8170:Dnah8	UTSW	17	30673823	missense	probably damaging	1.00
R8199:Dnah8	UTSW	17	30871419	missense	probably benign	0.06
R8253:Dnah8	UTSW	17	30760867	frame shift	probably null
R8270:Dnah8	UTSW	17	30840713	missense	probably damaging	1.00
R8291:Dnah8	UTSW	17	30765727	missense	probably damaging	1.00
R8334:Dnah8	UTSW	17	30769831	missense	probably benign	0.12
R8348:Dnah8	UTSW	17	30673840	missense	probably benign
R8348:Dnah8	UTSW	17	30736147	missense	probably damaging	0.96
R8354:Dnah8	UTSW	17	30643260	missense	probably benign	0.17
R8355:Dnah8	UTSW	17	30695178	missense	possibly damaging	0.89
R8439:Dnah8	UTSW	17	30760867	frame shift	probably null
R8448:Dnah8	UTSW	17	30673840	missense	probably benign
R8459:Dnah8	UTSW	17	30725247	critical splice donor site	probably null
R8462:Dnah8	UTSW	17	30656629	missense	probably damaging	1.00
R8506:Dnah8	UTSW	17	30721134	missense	probably benign
R8524:Dnah8	UTSW	17	30715498	missense	possibly damaging	0.95
R8555:Dnah8	UTSW	17	30721110	nonsense	probably null
R8698:Dnah8	UTSW	17	30875035	missense	probably damaging	1.00
R8719:Dnah8	UTSW	17	30741315	missense	probably damaging	0.97
R8778:Dnah8	UTSW	17	30760867	frame shift	probably null
R8781:Dnah8	UTSW	17	30725104	missense	probably damaging	1.00
R8821:Dnah8	UTSW	17	30794738	missense	probably damaging	1.00
R8864:Dnah8	UTSW	17	30762642	missense	possibly damaging	0.95
R8885:Dnah8	UTSW	17	30708312	missense	possibly damaging	0.83
R8983:Dnah8	UTSW	17	30851654	missense	probably damaging	0.98
R8994:Dnah8	UTSW	17	30790833	missense	probably benign	0.05
R9031:Dnah8	UTSW	17	30737427	missense	probably damaging	1.00
R9068:Dnah8	UTSW	17	30756755	missense	possibly damaging	0.63
R9225:Dnah8	UTSW	17	30635673	missense	probably benign	0.01
R9280:Dnah8	UTSW	17	30785097	missense	possibly damaging	0.52
R9291:Dnah8	UTSW	17	30725125	missense	probably damaging	1.00
R9314:Dnah8	UTSW	17	30771883	missense	probably benign
R9347:Dnah8	UTSW	17	30708359	missense	probably benign	0.00
R9393:Dnah8	UTSW	17	30653387	missense	possibly damaging	0.53
R9415:Dnah8	UTSW	17	30810323	missense	probably benign	0.02
R9458:Dnah8	UTSW	17	30830803	missense	probably damaging	1.00
R9465:Dnah8	UTSW	17	30760867	frame shift	probably null
R9518:Dnah8	UTSW	17	30760867	frame shift	probably null
R9524:Dnah8	UTSW	17	30760867	frame shift	probably null
R9564:Dnah8	UTSW	17	30713047	missense	probably benign	0.07
R9587:Dnah8	UTSW	17	30760867	frame shift	probably null
R9599:Dnah8	UTSW	17	30760867	frame shift	probably null
R9641:Dnah8	UTSW	17	30713055	missense	probably benign	0.13
R9674:Dnah8	UTSW	17	30779138	missense	possibly damaging	0.84
R9679:Dnah8	UTSW	17	30818141	missense	probably benign
R9789:Dnah8	UTSW	17	30761130	critical splice donor site	probably null
RF027:Dnah8	UTSW	17	30635476	frame shift	probably null
X0001:Dnah8	UTSW	17	30748680	missense	probably damaging	1.00
X0013:Dnah8	UTSW	17	30819186	missense	possibly damaging	0.71
Z1176:Dnah8	UTSW	17	30648540	missense	probably benign
Z1177:Dnah8	UTSW	17	30694033	missense	probably benign
Z1177:Dnah8	UTSW	17	30713095	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGAGAACAGACTCCTACAGC -3'
(R):5'- GTGTTATCCTCCAAAGCCCATC -3'

Sequencing Primer
(F):5'- TAATGGGTGAAAGTGCTTGCCAC -3'
(R):5'- TCCAAAGCCCATCCCACC -3'

Posted On

2019-10-07