Incidental Mutation 'R7424:Ankar'
ID575886
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Nameankyrin and armadillo repeat containing
Synonyms4932422E22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7424 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location72642980-72700579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 72680058 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 544 (N544T)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
Predicted Effect probably damaging
Transcript: ENSMUST00000053499
AA Change: N544T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: N544T

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211837
AA Change: N544T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212573
AA Change: N326T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,545 R71C probably damaging Het
Aanat A T 11: 116,595,629 probably benign Het
Ahrr G T 13: 74,257,545 S91* probably null Het
Ampd1 A T 3: 103,088,442 N223Y probably benign Het
Ankk1 A G 9: 49,418,750 S302P possibly damaging Het
Bcr T C 10: 75,157,100 V809A probably benign Het
Bpifb2 A G 2: 153,890,540 N353S possibly damaging Het
Ddx5 A T 11: 106,782,180 N506K probably benign Het
Dnaja1 A T 4: 40,730,244 I239F probably benign Het
Ethe1 C T 7: 24,606,251 T141I probably damaging Het
Fam160b2 T C 14: 70,594,007 H29R probably damaging Het
Gdap2 A T 3: 100,202,066 I36F unknown Het
Gm13030 A T 4: 138,871,266 D115E unknown Het
Gm13103 C T 4: 143,853,209 P455S probably benign Het
Gm17019 A T 5: 15,029,372 L227Q probably damaging Het
Gm9195 T A 14: 72,435,777 E2517D possibly damaging Het
Gramd2 T A 9: 59,708,071 V39D possibly damaging Het
Hmcn1 C T 1: 150,630,266 W3836* probably null Het
Hspa14 C T 2: 3,489,041 D494N possibly damaging Het
Ifit2 A G 19: 34,573,198 N46S probably benign Het
Ifna6 A T 4: 88,827,807 E131V possibly damaging Het
Ift140 T C 17: 25,037,036 V504A possibly damaging Het
Irgc1 T C 7: 24,432,228 N388S probably damaging Het
Itgal T A 7: 127,317,365 V743E probably benign Het
Itih5 T C 2: 10,245,637 S716P probably damaging Het
Kcnab1 A T 3: 65,266,503 K78N possibly damaging Het
Kif1a A T 1: 93,054,317 V787E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt39 A T 11: 99,518,091 V293E probably damaging Het
Lrrn4 A G 2: 132,869,743 F720S possibly damaging Het
Map2 G A 1: 66,414,824 A958T possibly damaging Het
Map3k9 A G 12: 81,724,097 S906P probably benign Het
Mdc1 T C 17: 35,853,309 S1250P probably benign Het
Meltf G A 16: 31,884,946 V164I probably damaging Het
Mtus1 C A 8: 41,022,406 V184F probably damaging Het
Myh1 A T 11: 67,213,663 D1015V probably damaging Het
Nkd1 G T 8: 88,585,175 V130L probably benign Het
Nsfl1c A G 2: 151,500,753 D81G probably benign Het
Nucb1 T C 7: 45,498,778 K204E possibly damaging Het
Nwd1 T G 8: 72,675,173 M774R possibly damaging Het
Olfr165 A T 16: 19,407,194 V274E probably damaging Het
Olfr262 A T 19: 12,240,954 S236T possibly damaging Het
Olfr654 G C 7: 104,588,700 E299Q probably damaging Het
Pcdh15 A T 10: 74,506,485 T1135S probably benign Het
Pfas A G 11: 69,000,092 I331T probably damaging Het
Plxna2 T A 1: 194,806,339 I1641N probably damaging Het
Ptar1 A T 19: 23,718,101 R311W probably damaging Het
Ranbp2 T G 10: 58,479,194 M1912R probably damaging Het
Rbm12 A G 2: 156,097,303 F350L possibly damaging Het
Sdhaf1 T C 7: 30,322,043 D96G probably benign Het
Serpinb6b T A 13: 32,968,667 M53K probably damaging Het
Sh2d6 A T 6: 72,517,164 L147Q probably benign Het
Slc19a2 T A 1: 164,260,876 C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St8sia2 T A 7: 73,960,902 Q211L possibly damaging Het
Sult2a2 T C 7: 13,734,897 I96T possibly damaging Het
Tab2 G T 10: 7,907,483 H678Q probably damaging Het
Tnfaip6 A G 2: 52,038,216 E14G probably benign Het
Trip11 A T 12: 101,885,198 L869H probably damaging Het
Tslp T C 18: 32,819,080 Y133H not run Het
Ttn T C 2: 76,740,990 I26520V probably damaging Het
Ttn A G 2: 76,932,143 V3374A unknown Het
Tubgcp2 T A 7: 140,007,924 I263F possibly damaging Het
Uaca A G 9: 60,870,110 E593G probably damaging Het
Unc13b C T 4: 43,172,235 T1021I unknown Het
Ush1c T A 7: 46,225,555 I131F probably benign Het
Usp24 C A 4: 106,379,107 D997E probably benign Het
Usp54 T C 14: 20,577,040 T517A probably benign Het
Vmn1r151 A T 7: 22,499,080 M200K possibly damaging Het
Vmn2r43 T C 7: 8,255,329 D295G probably damaging Het
Vmn2r70 G A 7: 85,563,868 P444S probably damaging Het
Vmn2r85 G T 10: 130,418,980 P612T probably damaging Het
Vps13d A T 4: 145,148,747 V1736D Het
Zbtb11 A T 16: 55,990,487 H336L probably benign Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 intron probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135
Predicted Primers PCR Primer
(F):5'- AGGACAACTGGCTACTCACTG -3'
(R):5'- CGCTCTTGTGACTGTTGATATAATC -3'

Sequencing Primer
(F):5'- CTGGCTACTCACTGCATTTAAATG -3'
(R):5'- GTGACTGTTGATATAATCTGTGTTCC -3'
Posted On2019-10-07